Serum Amyloid A (SAA1) (NM_001178006) Human Untagged Clone

CAT#: SC328192

SAA1 (untagged)-Human serum amyloid A1 (SAA1) transcript variant 3



  "NM_001178006" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SAA1 mouse monoclonal antibody, clone OTI2E4
    • 100 ul

CNY 2600.00
CNY 4250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIG4; SAA; SAA2; TP53I4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001178006, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTTCTCACGGGCCTGGTTTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGC
TTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCT
GACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTAT
GATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCAGCGATGCCAGA
GAGAATATCCAGAGATTCTTTGGCCATGGTGCGGAGGACTCGCTGGCTGATCAGGCTGCC
AATGAATGGGGCAGGAGTGGCAAAGACCCCAATCACTTCCGACCTGCTGGCCTGCCTGAG
AAATACTGA
Restriction Sites Please inquire     
ACCN NM_001178006
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001178006.1, NP_001171477.1
RefSeq Size 592 bp
RefSeq ORF 369 bp
Locus ID 6288
UniProt ID P02735
Gene Summary This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...