Cripto1 (TDGF1) (NM_001174136) Human Untagged Clone
CAT#: SC328269
TDGF1 (untagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1) transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CR; CR-1; CRGF; CRIPTO |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001174136, the custom clone sequence may differ by one or more nucleotides
ATGGCCATTTCTAAAGTCTTTGAACTGGGATTAGTTGCCGGGCTGGGCCATCAGGAATTT GCTCGTCCATCTCGGGGATACCTGGCCTTCAGAGATGACAGCATTTGGCCCCAGGAGGAG CCTGCAATTCGGCCTCGGTCTTCCCAGCGTGTGCCGCCCATGGGGATACAGCACAGTAAG GAGCTAAACAGAACCTGCTGCCTGAATGGGGGAACCTGCATGCTGGGGTCCTTTTGTGCC TGCCCTCCCTCCTTCTACGGACGGAACTGTGAGCACGATGTGCGCAAAGAGAACTGTGGG TCTGTGCCCCATGACACCTGGCTGCCCAAGAAGTGTTCCCTGTGTAAATGCTGGCACGGT CAGCTCCGCTGCTTTCCTCAGGCATTTCTACCCGGCTGTGATGGCCTTGTGATGGATGAG CACCTCGTGGCTTCCAGGACTCCAGAACTACCACCGTCTGCACGTACTACCACTTTTATG CTAGTTGGCATCTGCCTTTCTATACAAAGCTACTATTAA |
Restriction Sites | Please inquire |
ACCN | NM_001174136 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001174136.1, NP_001167607.1 |
RefSeq Size | 1784 bp |
RefSeq ORF | 519 bp |
Locus ID | 6997 |
UniProt ID | P13385 |
Protein Families | Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane |
Gene Summary | This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (2) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences causes translation initiation at a downstream AUG and results an isoform (2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229631 | TDGF1 (Myc-DDK-tagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 3990.00 |
|
RC229631L1 | Lenti-ORF clone of TDGF1 (Myc-DDK-tagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 5040.00 |
|
RC229631L2 | Lenti-ORF clone of TDGF1 (mGFP-tagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 5890.00 |
|
RC229631L3 | Lenti-ORF clone of TDGF1 (Myc-DDK-tagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 5890.00 |
|
RC229631L4 | Lenti-ORF clone of TDGF1 (mGFP-tagged)-Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 5890.00 |
|
RG229631 | TDGF1 (tGFP-tagged) - Human teratocarcinoma-derived growth factor 1 (TDGF1), transcript variant 2 |
CNY 4370.00 |
其它Cripto1产品