UQCC (UQCC1) (NM_001184977) Human Untagged Clone
CAT#: SC328369
UQCC (untagged)-Human ubiquinol-cytochrome c reductase complex chaperone (UQCC) nuclear gene encoding mitochondrial protein transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BFZB; C20orf44; CBP3; UQCC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328369 representing NM_001184977.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGTTGCTGGTGCGAGTCCTTAGGAACCAGACTAGCATTTCTCAGTGGGTTCCAGTATGCAGCCGA TTGATACCTGTGTCTCCTACCCAAGGACAGGGGGACAGGGCTCTGTCTCGCACTTCCCAGAAGATTAAG ATTGCGGCCCTGCGCATGTATACTAGCTGTGTGGAGAAAACTGACTTCGAGGAATTCTTTCTAAGGTGT CAGATGCCTGATACATTCAATTCATGGTTTCTTATAACCCTACTCCACGTCTGGATGTGTCTAGTCCGA ATGAAGCAGGAAGGCCGGAGTGGGAAGTACATGTGTCGTATCATAGTTCATTTTATGTGGGAGGATGTT CAGCAGCGCGGCAGAGTCATGGGGGTTAATCCCTATATCCTGAAGAAGAACATGATCCTCATGACAAAT CATTTCTATGCAGCGATCTTGGGATATGATGAGGGGATCCTTTCAGATGATCATGGGCTGGCCGCTGCC CTCTGGAGAACCTTCTTCAACCGGAAATGTGAAGACCCTCGACATCTTGAATTGCTGGTAGAGTATGTG AGGAAACAGATACAGTACCTGGACTCCATGAACGGGGAGGATCTGCTTCTGACAGGGGAGGTGAGCTGG CGCCCTCTAGTGGAGAAGAATCCTCAGAGCATCCTGAAGCCCCATTCTCCGACTTACAACGACGAGGGA CTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184977 |
Insert Size | 696 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001184977.1 |
RefSeq Size | 2257 bp |
RefSeq ORF | 696 bp |
Locus ID | 55245 |
UniProt ID | Q9NVA1 |
MW | 27 kDa |
Gene Summary | This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (3) lacks two in-frame exons compared to variant 1. The resulting isoform (c) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229731 | UQCC (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 2400.00 |
|
RC229731L3 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229731L4 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG229731 | UQCC (tGFP-tagged) - Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 4370.00 |