Glycogenin 1 (GYG1) (NM_001184721) Human Untagged Clone
CAT#: SC328457
GYG1 (untagged)-Human glycogenin 1 (GYG1) transcript variant 3
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GSD15; GYG |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328457 representing NM_001184721.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAGATCAGGCCTTTGTGACACTAACCACAAACGATGCCTACGCCAAAGGTGCCCTGGTCCTGGGA TCATCTCTGAAACAGCACAGGACCACCAGGAGGCTGGTCGTGCTCGCCACCCCTCAGGTCTCAGACTCC ATGAGAAAAGTTTTAGAGACAGTCTTTGATGAAGTCATCATGGTAGATGTCTTGGACAGTGGCGATTCT GCTCATCTAACCTTAATGAAGAGGCCAGAGTTGGGTGTCACGCTGACAAAGCTCCACTGCTGGTCGCTT ACACAGTATTCAAAATGTGTATTCATGGATGCAGATACTCTGGTCCTAGCAAATATTGATGATCTTTTT GACAGAGAAGAATTGTCAGCAGCACCAGACCCAGGGTGGCCTGACTGCTTCAATTCCGGAGTCTTCGTT TATCAGCCTTCAGTTGAAACATACAATCAGCTGTTGCATCTTGCTTCTGAGCAAGGTAGTTTTGATGGT GGGGACCAAGGCATACTGAACACATTTTTTAGCAGCTGGGCAACAACAGATATCAGAAAACACCTGCCG TTTATTTATAACCTAAGCAGCATCTCTATATACTCCTACCTCCCGGCATTTAAAGTGAAGATGTCTCAG GAGCCATATCACATCTGTCCCTTGGGGAGATCCCAGCTATGGCACAGCCGTTTGTATCCTCGGAAGAAC GGAAGGAACGATGGGAACAGGGCCAGGCTGATTATATGGGAGCAGATTCCTTTGACAACATCAAGAGGA AACTTGACACTTACCTCCAGTAGAAACACTGCATTTTTCTGTGAACACATCCACTTCACAAGCCTTGTT TCTGATACTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001184721 |
| Insert Size | 840 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001184721.1 |
| RefSeq Size | 1780 bp |
| RefSeq ORF | 840 bp |
| Locus ID | 2992 |
| UniProt ID | P46976 |
| MW | 31.5 kDa |
| Gene Summary | This gene encodes a member of the glycogenin family. Glycogenin is a glycosyltransferase that catalyzes the formation of a short glucose polymer from uridine diphosphate glucose in an autoglucosylation reaction. This reaction is followed by elongation and branching of the polymer, catalyzed by glycogen synthase and branching enzyme, to form glycogen. This gene is expressed in muscle and other tissues. Mutations in this gene result in glycogen storage disease XV. This gene has pseudogenes on chromosomes 1, 8 and 13 respectively. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010] Transcript Variant: This variant (3) lacks two consecutive exons in the 3' CDS, as compared to variant 1. The resulting isoform (3) is shorter and has a different C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229819 | GYG1 (Myc-DDK-tagged)-Human glycogenin 1 (GYG1), transcript variant 3 |
CNY 2400.00 |
|
| RC229819L3 | Lenti ORF clone of Human glycogenin 1 (GYG1), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229819L4 | Lenti ORF clone of Human glycogenin 1 (GYG1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG229819 | GYG1 (tGFP-tagged) - Human glycogenin 1 (GYG1), transcript variant 3 |
CNY 4370.00 |
其它Glycogenin 1产品
