MARCH I (MARCH1) (NM_001166373) Human Untagged Clone
CAT#: SC328477
41334 (untagged)-Human membrane-associated ring finger (C3HC4) 1 (MARCH1) transcript variant 1
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MARCH-I; MARCH1; RNF171 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001166373 edited
ATGCTGGGCTGGTGTGAAGCGATAGCCCGTAACCCTCACAGAATTCCAAACAACACGCGA ACACCCGAGATCTCAGGGGATTTGGCTGACGCCTCACAAACCTCCACATTGAATGAAAAA TCCCCAGGGCGATCTGCAAGTCGATCAAGTAACATTTCAAAAGCAAGCAGCCCAACAACA GGGACAGCTCCCAGGAGCCAGTCAAGGTTGTCTGTCTGTCCATCCACTCAGGACATCTGC AGAATCTGTCACTGCGAAGGGGATGAAGAGAGCCCCCTCATCACACCCTGTCGCTGCACT GGGACACTGCGCTTTGTCCACCAGTCCTGCCTCCACCAGTGGATAAAGAGCTCAGATACA CGCTGCTGTGAGCTCTGCAAGTATGACTTCATAATGGAGACCAAGCTCAAACCCCTCCGG AAGTGGGAGAAACTACAGATGACCACAAGTGAAAGGAGGAAAATATTCTGCTCTGTCACA TTCCACGTAATCGCGATCACCTGTGTGGTTTGGTCTTTGTATGTATTGATAGACCGGACA GCGGAGGAAATCAAGCAAGGCAATGACAATGGTGTCCTTGAATGGCCATTTTGGACAAAA CTGGTTGTGGTAGCCATTGGCTTCACAGGAGGTCTTGTCTTCATGTACGTACAGTGTAAA GTCTATGTTCAGTTGTGGCGCAGGCTGAAGGCCTACAACCGTGTGATCTTTGTACAAAAT TGCCCAGACACTGCCAAAAAACTGGAGAAGAACTTCTCATGTAATGTAAACACAGACATC AAAGATGCTGTGGTAGTGCCTGTACCACAAACAGGTGCAAATTCACTGCCATCTGCAGAG GGTGGCCCCCCTGAAGTTGTATCAGTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001166373 |
Insert Size | 2900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166373.1, NP_001159845.1 |
RefSeq Size | 5502 bp |
RefSeq ORF | 870 bp |
Locus ID | 55016 |
UniProt ID | Q8TCQ1 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229839 | MARCH1 (Myc-DDK-tagged)-Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1 |
CNY 2400.00 |
|
RC229839L1 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC229839L2 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC229839L3 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229839L4 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG229839 | 41334 (tGFP-tagged) - Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 1 |
CNY 4370.00 |
其它MARCH I产品