SLC25A21 (NM_001171170) Human Untagged Clone
CAT#: SC328484
SLC25A21 (untagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier) member 21 (SLC25A21) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MTDPS18; ODC; ODC1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328484 representing NM_001171170.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCGCCAAGCCTGAAGTCAGCTTAGTGCGCGAGGCTTCTCGGCAGATCGTGGCCGGTGGTTCTGCA GGTCTTGTAGAAATTTGCCTGATGCACCCCCTAGATGTGGTGAAAACCAGGTTTCAGATTCAGAGATGT GCAACCGATCCAAACAGTTATAAAAGCTTGGTAGACAGCTTTCGAATGATTTTCCAAATGGAAGGGTTA TTTGGTTTTTACAAGGGAATTCTGCCACCTATCTTGGCTGAAACCCCAAAAAGAGCAGTGAAGTTTTTC ACCTTTGAGCAGTACAAGAAATTGCTGGGATATGTGTCACTGTCACCAGCATTGACATTCGCCATTGCT GGATTGGGATCTGGACTAACAGAAGCCATTGTAGTTAACCCTTTTGAGGTAGTAAAAGTTGGCTTGCAA GCAAATCGGAACACATTTGCAGAGCAACCATCCACTGTGGGTTATGCAAGACAAATCATTAAGAAGGAA GGCTGGGGACTCCAGGGCCTCAACAAAGGATTAACTGCAACTTTGGGACGACATGGAGTTTTCAACATG GTTTATTTTGGCTTCTACTACAATGTCAAAAACATGATTCCTGTCAATAAGGATCCAATCTTGGAGTTT TGGAGAAAATTTGGGATTGGTCTTCTCTCGGGGACAATAGCCTCAGTCATTAACATCCCTTTTGATGTT GCCAAAAGTAGGATTCAAGGGCCTCAACCAGTTCCTGGAGAGATCAAGTACAGAACCTGTTTTAAAACA ATGGCAACAGTCTATCAGGAAGAAGGGATTTTAGCTTTGTACAAAGGCCTGCTTCCCAAGATTATGAGA CTTGGACCAGGTGGTGCAGTGATGCTGCTGGTTTATGAATACACCTATTCATGGCTTCAAGAGAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001171170 |
| Insert Size | 897 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001171170.1 |
| RefSeq Size | 1770 bp |
| RefSeq ORF | 897 bp |
| Locus ID | 89874 |
| UniProt ID | Q9BQT8 |
| MW | 33.1 kDa |
| Gene Summary | SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004] Transcript Variant: This variant (2) has a split 3' exon, as compared to variant 1. The resulting isoform (2) lacks the last aa, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229846 | SLC25A21 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2400.00 |
|
| RC229846L3 | Lenti-ORF clone of SLC25A21 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RC229846L4 | Lenti-ORF clone of SLC25A21 (mGFP-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RG229846 | SLC25A21 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4370.00 |
其它SLC25A21产品
