LEFTY2 (NM_001172425) Human Untagged Clone
CAT#: SC328536
LEFTY2 (untagged)-Human left-right determination factor 2 (LEFTY2) transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EBAF; LEFTA; LEFTYA; TGFB4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328536 representing NM_001172425.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGGCCCCTGTGGCTCTGCTGGGCACTCTGGGTGCTGCCCCTGGCTGGCCCCGGGGCGGCCCTGACC GAGGAGCAGCTCCTGGGCAGCCTGCTGCGGCAGCTGCAGCTCAGCGAGGTGCCCGTACTGGACAGGGCC GACATGGAGAAGCTGGTCATCCCCGCCCACGTGAGGGCCCAGTATGTAGTCCTGCTGCGGCGCAGCCAC GGGGACCGCTCCCGCGGAAAGAGGTTCAGCCAGAGCTTCCGAGAGGTGGCCGGCAGGTTCCTGGCGTCG GAGGCCGCGCTGCACAGGCACGGGCGGCTGTCCCCGCGCAGCGCCCAGGCCCGGGTGACCGTCGAGTGG CTGCGCGTCCGCGACGACGGCTCCAACCGCACCTCCCTCATCGACTCCAGGCTGGTGTCCGTCCACGAG AGCGGCTGGAAGGCCTTCGACGTGACCGAGGCCGTGAACTTCTGGCAGCAGCTGAGCCGGCCCCGGCAG CCGCTGCTGCTACAGGTGTCGGTGCAGAGGGAGCATCTGGGCCCGCTGGCGTCCGGCGCCCACAAGCTG GTCCGCTTTGCCTCGCAGGGGGCGCCAGCCGGGCTTGGGGAGCCCCAGCTGGAGCTGCACACCCTGGAC CTCAGGGACTATGGAGCTCAGGGCGACTGTGACCCTGAAGCACCAATGACCGAGGGCACCCGCTGCTGC CGCCAGGAGATGTACATTGACCTGCAGGGGATGAAGTGGGCCAAGAACTGGGTGCTGGAGCCCCCGGGC TTCCTGGCTTACGAGTGTGTGGGCACCTGCCAGCAGCCCCCGGAGGCCCTGGCCTTCAATTGGCCATTT CTGGGGCCGCGACAGTGTATCGCCTCGGAGACTGCCTCGCTGCCCATGATCGTCAGCATCAAGGAGGGA GGCAGGACCAGGCCCCAGGTGGTCAGCCTGCCCAACATGAGGGTGCAGAAGTGCAGCTGTGCCTCGGAT GGGGCGCTCGTGCCAAGGAGGCTCCAGCCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001172425 |
| Insert Size | 999 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001172425.1 |
| RefSeq Size | 2085 bp |
| RefSeq ORF | 999 bp |
| Locus ID | 7044 |
| UniProt ID | O00292 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | TGF-beta signaling pathway |
| MW | 37.1 kDa |
| Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. The protein may also play a role in endometrial bleeding. Mutations in this gene have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. This gene is closely linked to both a related family member and a related pseudogene. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. This isoform (2) lacks a portion of the mature peptide compared to isoform 1, but may undergo proteolytic processing similar to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229898 | LEFTY2 (Myc-DDK-tagged)-Human left-right determination factor 2 (LEFTY2), transcript variant 2 |
CNY 2400.00 |
|
| RC229898L3 | Lenti ORF clone of Human left-right determination factor 2 (LEFTY2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229898L4 | Lenti ORF clone of Human left-right determination factor 2 (LEFTY2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG229898 | LEFTY2 (tGFP-tagged) - Human left-right determination factor 2 (LEFTY2), transcript variant 2 |
CNY 4370.00 |
