BRUNOL6 (CELF6) (NM_001172685) Human Untagged Clone

CAT#: SC328552

CELF6 (untagged)-Human CUGBP Elav-like family member 6 (CELF6) transcript variant 3



  "NM_001172685" in other vectors (4)

CNY 5610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CELF6 mouse monoclonal antibody,clone OTI5G3
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRUNOL6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328552 representing NM_001172685.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATCGTCCGATCCAAGTGAAGCCAGCTGCCAGTGAGGGCCGAGGAGAGGACCGAAAGCTGTTTGTG
GGGATGCTGGGCAAGCAGCAGGGTGAGGAGGACGTCAGACGCCTGTTCCAGCCCTTTGGCCACATCGAG
GAGTGCACGGTCCTGCGGAGTCCTGACGGCACCAGTAAAGGCTGTGCCTTTGTGAAGTTCGGGAGTCAA
GGGGAAGCTCAGGCGGCCATCCGGGGTCTGCACGGCAGCCGGACCATGGCGGGCGCCTCGTCCAGCCTC
GTGGTCAAGCTGGCGGACACCGACCGGGAGCGCGCGCTGCGGCGGATGCAGCAGATGGCCGGCCACCTG
GGCGCCTTCCACCCCGCGCCACTGCCGCTAGGGGCCTGCGGCGCCTACACCACGGCGATCCTGCAGCAC
CAGGCGGCCCTGCTGGCGGCGGCACAGGGCCCAGGCCTAGGCCCGGTGGCGGCAGTGGCGGCCCAGATG
CAACACGTGGCGGCCTTTAGCCTGGTAGCTGCGCCTCTGTTGCCCGCGGCAGCCAACTCCCCGCCTGGC
AGCGGCCCTGGCACCCTCCCAGGTCTTCCGGCGCCCATCGGGGTCAATGGATTCGGCCCTCTGACCCCC
CAGACCAATGGCCAGCCGGGCTCCGACACGCTCTACAATAACGGGCTCTCCCCTTATCCAGCAGCCTAT
CCGTCGGCCTATGCCCCAGTGAGCACAGCTTTTCCCCAGCAGCCTTCAGCCCTGCCCCAGCAGCAGAGA
GAAGGCCCCGAAGGCTGTAACCTCTTCATCTATCACCTGCCTCAGGAGTTTGGTGATGCGGAACTCATA
CAGACATTCCTGCCCTTTGGAGCCGTTGTCTCTGCTAAAGTCTTTGTGGATCGAGCCACCAACCAGAGC
AAGTGTTTTGGGTTTGTTAGTTTTGACAATCCAACTAGTGCCCAGACTGCTATTCAGGCGATGAATGGC
TTTCAAATTGGCATGAAGAGGCTCAAGGTCCAGCTAAAGCGGCCCAAGGATGCCAACCGGCCTTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001172685
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172685.1
RefSeq Size 2854 bp
RefSeq ORF 1035 bp
Locus ID 60677
UniProt ID Q96J87
MW 36.2 kDa
Gene Summary Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) has an alternate 5' sequence, which results in a downstream AUG start codon, and lacks an in-frame coding exon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus and lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...