KIST (UHMK1) (NM_001184763) Human Untagged Clone

CAT#: SC328554

UHMK1 (untagged)-Human U2AF homology motif (UHM) kinase 1 (UHMK1) transcript variant 2



  "NM_001184763" in other vectors (4)

CNY 5610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
UHMK1 (KIST) mouse monoclonal antibody, clone OTI2H4 (formerly 2H4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KIS; KIST; P-CIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328554 representing NM_001184763.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTCTTACCAGACCGAAGGTCTGTGTTGACCTTAACCGGAGAGTGACTTTGTATGGAGTGTTTACA
ATCCACTTTTCTCCAAATGTGCCATCACGCTGTCTGTTGCTTGAACTCCTGGATGTCAGTGTTTCGGAA
TTGCTCTTATATTCCAGTCACCAGGGTTGTTCCATGTGGATGATACAGCATTGTGCCCGAGATGTTTTG
GAGGCCCTTGCTTTTCTTCATCATGAGGGCTATGTCCATGCGGACCTCAAACCACGTAACATATTGTGG
AGTGCAGAGAATGAATGTTTTAAACTCATTGACTTTGGACTTAGCTTCAAAGAAGGCAATCAGGATGTA
AAGTATATTCAGACAGACGGGTATCGGGCTCCAGAAGCAGAATTGCAAAATTGCTTGGCCCAGGCTGGC
CTGCAGAGTGATACAGAATGTACCTCAGCTGTTGATCTGTGGAGCCTAGGAATCATTTTACTGGAAATG
TTCTCAGGAATGAAACTGAAACATACAGTCAGATCTCAGGAATGGAAGGCAAACAGTTCTGCTATTATT
GATCACATATTTGCCAGTAAAGCAGTGGTGAATGCCGCAATTCCAGCCTATCACCTAAGAGACCTTATC
AAAAGCATGCTTCATGATGATCCAAGCAGAAGAATTCCTGCTGAAATGGCATTGTGCAGCCCATTCTTT
AGCATTCCTTTTGCCCCTCATATTGAAGATCTGGTCATGCTTCCCACTCCAGTGCTAAGACTGCTGAAT
GTGCTGGATGATGATTATCTTGAGAATGAAGAGGAATATGAAGATGTTGTAGAAGATGTAAAAGAGGAG
TGTCAAAAATATGGACCAGTGGTATCTCTACTTGTTCCAAAGGAAAATCCTGGCAGAGGACAAGTCTTT
GTTGAGTATGCAAATGCTGGTGATTCCAAAGCTGCGCAGAAATTACTGACTGGAAGGATGTTTGATGGG
AAGTTTGTTGTGGCTACATTCTACCCGCTGAGTGCCTACAAGAGGGGATATCTGTATCAAACCTTGCTT
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184763
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184763.1
RefSeq Size 8194 bp
RefSeq ORF 1038 bp
Locus ID 127933
UniProt ID Q8TAS1
Protein Families Druggable Genome, Protein Kinase
MW 39 kDa
Gene Summary The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...