CNDP2 (NM_001168499) Human Untagged Clone
CAT#: SC328622
CNDP2 (untagged)-Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2) transcript variant 2
CNY 3656.00
CNY 6370.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CN2; CPGL; HEL-S-13; HsT2298; PEPA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001168499, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCCTCACTACCCTGTTTAAGTACATAGATGAAAATCAGGATCGCTACATTAAG AAACTCGCAAAATGGGTGGCTATCCAGAGTGTGTCTGCGTGGCCGGAGAAGAGAGGCGAA ATCAGGAGGATGATGGAAGTTGCTGCTGCAGATGTTAAGCAGTTGGGGGGCTCTGTGGAA CTGGTGGATATCGGAAAACAAAAGGAGATTCCTGTCAACGTCCGATTCTGCCTCGAAGGC ATGGAGGAGTCAGGCTCTGAGGGCCTAGACGAGCTGATTTTTGCCCGGAAAGACACATTC TTTAAGGATGTGGACTATGTCTGCATTTCTGACAATTACTGGCTGGGAAAGAAGAAGCCC TGCATCACCTACGGCCTCAGGGGCATTTGCTACTTTTTCATCGAGGTGGAGTGCAGCAAC AAAGACCTCCATTCTGGGGTGTACGGGGGCTCGGTGCATGAGGCCATGACTGATCTCATT TTGCTGATGGGCTCTTTGGTGGACAAGAGGGGGAACATCCTGATCCCCGGCATTAACGAG GCCGTGGCCGCCGTCACGGAAGAGGAGCACAAGCTGTACGACGACATCGACTTTGACATA GAGGAGTTTGCCAAGGATGTGGGGGCGCAGATCCTCCTGCACAGCCACAAGAAAGACATC CTCATGCACCGATGGCGGTACCCGTCTCTGTCCCTCCATGGCATCGAAGGCGCCTTCTCT GGGTCTGGGGCCAAGACCGTGATTCCCAGGAAGGTGGTTGGCAAGTTCTCCATCAGGCTC GTGCCGAACATGACTCCTGAAGTCGTCGGCGAGCAGGTCACAAGCTACCTAACTAAGAAG TTTGCTGAACTACGCAGCCCCAATGAGTTCAAGGTGTACATGGGCCACGGTGGGAAGCCC TGGGTCTCCGACTTCAGTCACCCTCATTACCTGGCTGGGAGAAGAGCCATGAAGACAGTT TTTGGTGTTGAGCCAGACTTGACCAGGGAAGGCGGCAGTATTCCCGTGACCTTGACCTTT CAGGAGGCCACGGGCAAGAACGTCATGCTGCTGCCTGTGGGGTCAGCGGATGACGGAGCC CACTCCCAGAATGAAAAGCTCAACAGGTATAACTACATAGAGGGAACCAAGATGCTGGCC GCGTACCTGTATGAGGTCTCCCAGCTGAAGGACTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001168499 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001168499.1, NP_001161971.1 |
| RefSeq Size | 4964 bp |
| RefSeq ORF | 1176 bp |
| Locus ID | 55748 |
| UniProt ID | Q96KP4 |
| Protein Families | Protease |
| Gene Summary | CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the central coding region, compared to variant 1. The resulting isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229984 | CNDP2 (Myc-DDK-tagged)-Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2), transcript variant 2 |
CNY 3656.00 |
|
| RC229984L3 | Lenti ORF clone of Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229984L4 | Lenti ORF clone of Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG229984 | CNDP2 (tGFP-tagged) - Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2), transcript variant 2 |
CNY 4370.00 |
