ADH7 (NM_001166504) Human Untagged Clone

CAT#: SC328628

ADH7 (untagged)-Human alcohol dehydrogenase 7 (class IV) mu or sigma polypeptide (ADH7) transcript variant 1



  "NM_001166504" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
ADH7 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADH4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166504, the custom clone sequence may differ by one or more nucleotides


ATGAAATGCTTGGTGAGCAGGCATACAGTGAGGGAAACACTGGATATGGTGTTTCAGAGAATGTCAGTGG
AAGCAGGGGTTATTAAATGCAAAGCAGCTGTGCTTTGGGAGCAGAAGCAACCCTTCTCCATTGAGGAAAT
AGAAGTTGCCCCACCAAAGACTAAAGAAGTTCGCATTAAGATTTTGGCCACAGGAATCTGTCGCACAGAT
GACCATGTGATAAAAGGAACAATGGTGTCCAAGTTTCCAGTGATTGTGGGACATGAGGCAACTGGGATTG
TAGAGAGCATTGGAGAAGGAGTGACTACAGTGAAACCAGGTGACAAAGTCATCCCTCTCTTTCTGCCACA
ATGTAGAGAATGCAATGCTTGTCGCAACCCAGATGGCAACCTTTGCATTAGGAGCGATATTACTGGTCGT
GGAGTACTGGCTGATGGCACCACCAGATTTACATGCAAGGGCAAACCAGTCCACCACTTCATGAACACCA
GTACATTTACCGAGTACACAGTGGTGGATGAATCTTCTGTTGCTAAGATTGATGATGCAGCTCCTCCTGA
GAAAGTCTGTTTAATTGGCTGTGGGTTTTCCACTGGATATGGCGCTGCTGTTAAAACTGGCAAGGTCAAA
CCTGGTTCCACTTGCGTCGTCTTTGGCCTGGGAGGAGTTGGCCTGTCAGTCATCATGGGCTGTAAGTCAG
CTGGTGCATCTAGGATCATTGGGATTGACCTCAACAAAGACAAATTTGAGAAGGCCATGGCTGTAGGTGC
CACTGAGTGTATCAGTCCCAAGGACTCTACCAAACCCATCAGTGAGGTGCTGTCAGAAATGACAGGCAAC
AACGTGGGATACACCTTTGAAGTTATTGGGCATCTTGAAACCATGATTGATGCCCTGGCATCCTGCCACA
TGAACTATGGGACCAGCGTGGTTGTAGGAGTTCCTCCATCAGCCAAGATGCTCACCTATGACCCGATGTT
GCTCTTCACTGGACGCACATGGAAGGGATGTGTCTTTGGAGGTTTGAAAAGCAGAGATGATGTCCCAAAA
CTAGTGACTGAGTTCCTGGCAAAGAAATTTGACCTGGACCAGTTGATAACTCATGTTTTACCATTTAAAA
AAATCAGTGAAGGATTTGAGCTGCTCAATTCAGGACAAAGCATTCGAACGGTCCTGACGTTTTGA


Restriction Sites Please inquire     
ACCN NM_001166504
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166504.1, NP_001159976.1
RefSeq Size 2120 bp
RefSeq ORF 1185 bp
Locus ID 131
UniProt ID P40394
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Fatty acid metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism, Tyrosine metabolism
Gene Summary This gene encodes class IV alcohol dehydrogenase 7 mu or sigma subunit, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The enzyme encoded by this gene is inefficient in ethanol oxidation, but is the most active as a retinol dehydrogenase; thus it may participate in the synthesis of retinoic acid, a hormone important for cellular differentiation. The expression of this gene is much more abundant in stomach than liver, thus differing from the other known gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...