SP7 (NM_001173467) Human Untagged Clone
CAT#: SC328709
SP7 (untagged)-Human Sp7 transcription factor (SP7) transcript variant 1
CNY 5,856.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OI11; OI12; osterix; OSX |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001173467, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCCTCCCTGCTTGAGGAGGAAGTTCACTATGGCTCCAGTCCCCTGGCCATGCTG ACGGCAGCGTGCAGCAAATTTGGTGGCTCTAGCCCTCTGCGGGACTCAACAACTCTGGGC AAAGCAGGCACAAAGAAGCCGTACTCTGTGGGCAGTGACCTTTCAGCCTCCAAAACCATG GGGGATGCTTATCCAGCCCCCTTTACAAGCACTAATGGGCTCCTTTCACCTGCAGGCAGT CCTCCAGCACCCACCTCAGGCTATGCTAATGATTACCCTCCCTTTTCCCACTCATTCCCT GGGCCCACAGGCACCCAGGACCCTGGGCTACTAGTGCCCAAGGGGCACAGCTCTTCTGAC TGTCTGCCCAGTGTCTACACCTCTCTGGACATGACACACCCCTATGGCTCCTGGTACAAG GCAGGCATCCATGCAGGCATTTCACCAGGCCCAGGCAACACTCCTACTCCATGGTGGGAT ATGCACCCTGGAGGCAACTGGCTAGGTGGTGGGCAGGGCCAGGGTGATGGGCTGCAAGGG ACACTGCCCACAGGTCCAGCTCAGCCTCCACTGAACCCCCAGCTGCCCACCTACCCATCT GACTTTGCTCCCCTTAATCCAGCCCCCTACCCAGCTCCCCACCTCTTGCAACCAGGGCCC CAGCATGTCTTGCCCCAAGATGTCTATAAACCCAAGGCAGTGGGAAATAGTGGGCAGCTA GAAGGGAGTGGTGGAGCCAAACCCCCACGGGGTGCAAGCACTGGGGGTAGTGGTGGATAT GGGGGCAGTGGGGCAGGGCGCTCCTCCTGCGACTGCCCTAATTGCCAGGAGCTAGAGCGG CTGGGAGCAGCAGCGGCTGGGCTGCGGAAGAAGCCCATCCACAGCTGCCACATCCCTGGC TGCGGCAAGGTGTATGGCAAGGCTTCGCACCTGAAGGCCCACTTGCGCTGGCACACAGGC GAGAGGCCCTTCGTCTGCAACTGGCTCTTCTGCGGCAAGAGGTTCACTCGTTCGGATGAG CTGGAGCGTCATGTGCGCACTCACACCCGGGAGAAGAAGTTCACCTGCCTGCTCTGCTCC AAGCGCTTTACCCGAAGCGACCACCTGAGCAAACACCAGCGCACCCATGGAGAACCAGGC CCGGGTCCCCCTCCCAGTGGCCCCAAGGAGCTGGGGGAGGGCCGCAGCACGGGGGAAGAG GAGGCCAGTCAGACGCCCCGACCTTCTGCCTCGCCAGCAACCCCAGAGAAAGCCCCTGGA GGCAGCCCTGAGCAGAGCAACTTGCTGGAGATCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001173467 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173467.1, NP_001166938.1 |
RefSeq Size | 3010 bp |
RefSeq ORF | 1296 bp |
Locus ID | 121340 |
UniProt ID | Q8TDD2 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein is a bone specific transcription factor and is required for osteoblast differentiation and bone formation.[provided by RefSeq, Jul 2010] Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1 and 2 encode the same isoform. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
β-catenin signaling induces the osteoblastogenic differentiation of human pre-osteoblastic and bone marrow stromal cells mainly through the upregulation of osterix expression
,null,
International Journal of Molecular Medicine
,PubMed ID 26496941
[SP7]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230071 | SP7 (Myc-DDK-tagged)-Human Sp7 transcription factor (SP7), transcript variant 1 |
CNY 5,488.00 |
|
RC230071L3 | Lenti-ORF clone of SP7 (Myc-DDK-tagged)-Human Sp7 transcription factor (SP7), transcript variant 1 |
CNY 5,890.00 |
|
RC230071L4 | Lenti-ORF clone of SP7 (mGFP-tagged)-Human Sp7 transcription factor (SP7), transcript variant 1 |
CNY 5,890.00 |
|
RG230071 | SP7 (tGFP-tagged) - Human Sp7 transcription factor (SP7), transcript variant 1 |
CNY 4,370.00 |