ZFX (NM_001178095) Human Untagged Clone
CAT#: SC328710
ZFX (untagged)-Human zinc finger protein X-linked (ZFX) transcript variant 5
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ZNF926 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328710 representing NM_001178095.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATGAAGATGGGCTTGAATTACAACAAGAGCCAAACTCATTTTTTGATGCAACAGGAGCTGATGGT ACACACATGGATGGTGATCAAATTGTTGTGGAAGTACAAGAAACTGTTTTTGTTTCAGATGTTGTGGAT TCAGACATAACTGTGCATAACTTTGTTCCTGATGACCCAGATTCAGTTGTAATCCAAGATGTTATTGAG GACGTTGTTATAGAAGATGTTCAGTGCCCAGATATCATGGAAGAAGCAGATGTGTCTGAAACGGTCATC ATTCCTGAGCAAGTGCTGGACTCAGATGTAACTGAAGAAGTTTCTTTAGCACATTGCACAGTCCCAGAT GATGTTTTAGCTTCTGACATTACTTCAGCCTCAATGTCTATGCCAGAACACGTCTTGACGGGTGATTCT ATACATGTGTCTGACGTTGGACATGTTGGACATGTTGGACATGTTGAACATGTGGTTCATGATAGTGTA GTGGAAGCAGAAATTGTCACTGATCCTCTGACTACCGACGTAGTTTCAGAAGAAGTATTGGTAGCAGAC TGTGCCTCTGAAGCAGTCATAGATGCCAATGGGATCCCTGTGGACCAGCAGGATGATGACAAAGGCAAC TGTGAGGACTACCTTATGATTTCCTTGGATGATGCTGGCAAAATAGAACACGATGGTTCTTCTGGAATG ACCATGGACACAGAGTCGGAAATTGATCCTTGTAAAGTGGATGGCACTTGCCCTGAGGTCATCAAGGTG TACATTTTTAAAGCTGACCCTGGAGAAGATGACTTAGGTGGAACTGTAGACATTGTGGAGAGTGAGCCT GAGAATGATCATGGAGTTGAACTGCTTGATCAGAACAGCAGTATTCGTGTTCCCAGGGAAAAGATGGTT TATATGACTGTCAATGACTCTCAGCCAGAAGATGAAGATTTAAATGTTGCTGAAATCGCTGACGAAGTT TATATGGAAGTGATCGTAGGAGAGGAGGATGCTGCAGCAGCAGCGGCAGCCGCCGCCGTGCACGAGCAG CAAATGGATGACAATGAAATCAAAACCTTCATGCCGATTGCATGGGCAGCAGCTTATGGTAATAATTCT GATGGAATTGAAAACCGGAATGGCACTGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGC AGACTGGCTAAACAAAAACCAAAGAAAAGGAGAAGACCTGATTCCAGGCAGTACCAAACAGGTGAGGGC GCACGAGTTCCATGGCGCAGCGTGCTCTGCGAGCTCTCAGAGGAAACTCTACAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001178095 |
| Insert Size | 1299 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001178095.1 |
| RefSeq Size | 7534 bp |
| RefSeq ORF | 1299 bp |
| Locus ID | 7543 |
| Protein Families | Transcription Factors |
| MW | 46.8 kDa |
| Gene Summary | This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010] Transcript Variant: This variant (5) lacks two exons in the 5' UTR and has an additional segment in the 3' CDS, as compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC230072 | ZFX (Myc-DDK-tagged)-Human zinc finger protein, X-linked (ZFX), transcript variant 5 |
CNY 3656.00 |
|
| RC230072L3 | Lenti ORF clone of Human zinc finger protein, X-linked (ZFX), transcript variant 5, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC230072L4 | Lenti ORF clone of Human zinc finger protein, X-linked (ZFX), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
| RG230072 | ZFX (tGFP-tagged) - Human zinc finger protein, X-linked (ZFX), transcript variant 5 |
CNY 4370.00 |
