WNT5A (NM_001256105) Human Untagged Clone

CAT#: SC329400

WNT5A (untagged) - Homo sapiens wingless-type MMTV integration site family, member 5A (WNT5A), transcript variant 2



  "NM_001256105" in other vectors (2)

CNY 3,520.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-WNT5A Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hWNT5A
Vector pCMV6-Entry
Sequence Data
>SC329400 representing NM_001256105.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAG
GTTGTAATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTATAT
ATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAGAAACTGTGCCAC
TTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAA
TTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAACACCTCTGTTTTTGGCAGGGTGATGCAGATA
GGCAGCCGCGAGACGGCCTTCACATACGCGGTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCG
TGCCGCGAGGGCGAGCTGTCCACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGAC
TGGCTCTGGGGCGGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCC
CGCGAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTGCACAAC
AACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGCCATGGGGTGTCCGGC
TCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGCAAGGTGGGTGATGCCCTGAAGGAG
AAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGCCGGGGCAAGTTGGTACAGGTCAACAGCCGCTTC
AACTCGCCCACCACACAAGACCTGGTCTACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGC
ACCGGCTCGCTGGGCACGCAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTC
ATGTGCTGCGGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256105
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256105.1
RefSeq Size 5599 bp
RefSeq ORF 1098 bp
Locus ID 7474
UniProt ID P41221
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
MW 40.9 kDa
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...