FRMPD2 (NM_001042512) Human Untagged Clone

CAT#: SC329407

FRMPD2 (untagged) - Homo sapiens FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4



  "NM_001042512" in other vectors (5)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal FRMPD2 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PDZD5C; PDZK4; PDZK5C
Vector pCMV6-Entry
Sequence Data
>SC329407 representing NM_001042512.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACATCTATCCCTTTCCCAGGTGACCGACTCCTGCAGGTGGATGGAGTGATTCTGTGCGGCCTCACC
CACAAGCAGGCTGTGCAGTGCCTGAAGGGTCCTGGGCAGGTTGCAAGACTGGTCTTAGAGAGAAGAGTC
CCCAGGAGTACACAGCAGTGTCCTTCTGCTAATGACAGCATGGGAGATGAACGCACGGCTGTTTCCTTG
GTAACAGCCTTGCCTGGCAGGCCTTCGAGCTGTGTCTCAGTGACAGATGGTCCTAAGTTTGAAGTCAAA
CTAAAAAAGAATGCCAATGGTTTGGGATTCAGTTTCGTGCAGATGGAGAAAGAGAGCTGCAGCCATCTC
AAAAGTGATCTTGTGAGGATTAAGAGGCTCTTTCCGGGGCAGCCAGCTGAGGAGAATGGGGCCATTGCA
GCTGGTGACATTATCCTGGCCGTGAATGGAAGGTCCACGGAAGGCCTCATCTTCCAGGAGGTGCTGCAT
TTACTGAGAGGGGCCCCACAGGAAGTCACGCTCCTCCTTTGCCGACCCCCTCCAGGTGCGCTGCCTGAG
CTGGAGCAGGAATGGCAGACACCTGAACTCTCAGCTGACAAAGAATTCACCAGGGCAACATGTACTGAC
TCATGTACCAGCCCCATCCTGGATCAAGAGGACAGCTGGAGGGACAGTGCCTCCCCAGATGCAGGGGAA
GGCCTGGGTCTCAGGCCAGAGTCTTCCCAAAAGGCCATCAGAGAGGCACAATGGGGCCAAAACAGAGAG
AGACCTTGGGCCAGTTCCTTGACACATTCTCCTGAGTCCCACCCTCATTTATGCAAACTTCACCAAGAA
AGGGATGAATCAACATTGGCGACCTCTTTGGAAAAGGATGTGAGGCAAAACTGCTATTCAGTTTGTGAT
ATCATGAGACTTGGAAGATATTCCTTCTCATCTCCTCTAACCAGACTTTCGACAGATATTTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001042512
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042512.2
RefSeq Size 1892 bp
RefSeq ORF 963 bp
Locus ID 143162
UniProt ID Q68DX3
MW 35.1 kDa
Gene Summary This gene encodes a peripheral membrane protein and is located in a region of chromosome 10q that contains a segmental duplication. This copy of the gene is full-length and is in the telomeric duplicated region. Two other more centromerically proximal copies of the gene are partial and may represent pseudogenes. This full-length gene appears to function in the establishment and maintenance of cell polarization. The protein is recruited to cell-cell junctions in an E-cadherin-dependent manner, and is selectively localized at the basolateral membrane in polarized epithelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (4) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 3. The encoded isoform (4) has a distinct and significantly shorter N-terminus, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...