LRTOMT (NM_001145310) Human Untagged Clone

CAT#: SC329411

LRTOMT (untagged) - Homo sapiens leucine rich transmembrane and O-methyltransferase domain containing (LRTOMT), transcript variant 6



  "NM_001145310" in other vectors (7)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal Anti-LRRC51 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFAP111; DFNB63; LRRC51
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC329411 representing NM_001145310.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAACCCCATGGAGGAAGAGAAAGGGTATAGCAGGCCCTGGACTCCCCGACCTGTCCTGTGCTCTG
GTCCTCCAGCCCAGCCTCCGAGACTGCCTGTCAGGGCTGCGGATCGAGGAGCGGGCCTTCAGCTACGTG
CTCACCCATGCCCTGCCCGGTGACCCTGGTCACATCCTCACCACCCTGGACCACTGGAGCAGCCGCTGC
GAGTACTTGAGCCACATGGGGCCTGTCAAAGGTCAGATCCTGATGCGGCTGGTGGAGGAGAAGGCCCCT
GCTTGTGTGCTGGAATTGGGAACCTACTGTGGATACTCTACCCTGCTTATTGCCCGAGCCCTGCCCCCT
GGGGGTCGCCTTCTTACTGTGGAGCGGGACCCACGCACGGCAGCAGTGGCTGAAAAACTCATCCGCCTG
GCCGGCTTTGATGAGCACATGGTGGAGCTCATCGTGGGCAGCTCAGAGGACGTGATCCCGTGCCTACGC
ACCCAGTATCAGCTGAGTCGGGCAGACCTGGTGCTCCTGGCACACCGGCCACGATGTTACCTGAGGGAC
CTGCAGCTGCTGGAGGCCCATGCCCTACTGCCAGCAGGTGCCACCGTGCTGGCTGACCATGTGCTCTTC
CCTGGTGCACCCCGCTTCTTGCAGTATGCTAAGAGCTGTGGCCGCTACCGCTGCCGCCTCCACCACACT
GGCCTTCCAGACTTCCCTGCCATCAAGGATGGAATAGCTCAGCTCACCTATGCTGGACCAGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145310
Insert Size 756 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145310.3
RefSeq Size 3710 bp
RefSeq ORF 756 bp
Locus ID 220074
UniProt ID Q8WZ04
MW 27.5 kDa
Gene Summary This locus represents naturally occurring readthrough transcription between the neighboring LRRC51 (leucine-rich repeat containing 51) and TOMT (transmembrane O-methyltransferase) genes on chromosome 11. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. Multiple reports implicate mutations in this gene in nonsyndromic deafness.[provided by RefSeq, Feb 2021]
Transcript Variant: This variant (6, also known as E') represents the long transcript form. It lacks the 3' terminal exon and includes several alternate exons, compared to variant 1. This variant encodes isoform LRTOMT2b, which lacks an internal segment including the transmembrane region, compared to isoform LRTOMT2a. Isoform LRTOMT2b is a catechol-O-methyltransferase, which is supported by Western blot as reported in PMID: 18953341.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...