GNGT2 (NM_001198754) Human Untagged Clone

CAT#: SC329471

GNGT2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 2



  "NM_001198754" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GNGT2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G-GAMMA-8; G-GAMMA-C; GNG9; GNGT8
Vector pCMV6-Entry
Sequence Data
>SC329471 representing NM_001198754.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCAGGATCTCAGCGAGAAGGACCTGTTGAAGATGGAGGTGGAGCAGCTGAAGAAAGAAGTGAAA
AACACAAGAATTCCGATTTCCAAAGCGGGAAAGGAAATCAAGGAGTACGTGGAGGCCCAAGCAGGAAAC
GATCCTTTTCTCAAAGGCATCCCTGAGGACAAGAATCCCTTCAAGGAGAAAGGTGGCTGTCTGATAAGC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001198754
Insert Size 210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001198754.1
RefSeq Size 1013 bp
RefSeq ORF 210 bp
Locus ID 2793
UniProt ID O14610
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
MW 7.7 kDa
Gene Summary Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...