Cathepsin V (CTSV) (NM_001201575) Human Untagged Clone

CAT#: SC329640

CTSL2 (untagged) - Homo sapiens cathepsin V (CTSV), transcript variant 2



  "NM_001201575" in other vectors (2)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal CATL2 (Cleaved-Leu114) antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CATL2; CTSL2; CTSU
Vector pCMV6-Entry
Sequence Data
>SC329640 representing NM_001201575.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCTTTCGCTCGTCCTGGCTGCCTTTTGCTTGGGAATAGCCTCCGCTGTTCCAAAATTTGACCAA
AATTTGGATACAAAGTGGTACCAGTGGAAGGCAACACACAGAAGATTATATGGCGCGAATGAAGAAGGA
TGGAGGAGAGCAGTGTGGGAAAAGAATATGAAAATGATTGAACTGCACAATGGGGAATACAGCCAAGGG
AAACATGGCTTCACAATGGCCATGAATGCTTTTGGTGACATGACCAATGAAGAATTCAGGCAGATGATG
GGTTGCTTTCGAAACCAGAAATTCAGGAAGGGGAAAGTGTTCCGTGAGCCTCTGTTTCTTGATCTTCCC
AAATCTGTGGATTGGAGAAAGAAAGGCTACGTGACGCCAGTGAAGAATCAGAAACAGTGTGGTTCTTGT
TGGGCTTTTAGTGCGACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAAACTTGTCTCACTG
AGCGAGCAGAATCTGGTGGACTGTTCGCGTCCTCAAGGCAATCAGGGCTGCAATGGTGGCTTCATGGCT
AGGGCCTTCCAGTATGTCAAGGAGAACGGAGGCCTGGACTCTGAGGAATCCTATCCATATGTAGCAGTG
GATGAAATCTGTAAGTACAGACCTGAGAATTCTGTTGCTAATGACACTGGCTTCACAGTGGTCGCACCT
GGAAAGGAGAAGGCCCTGATGAAAGCAGTCGCAACTGTGGGGCCCATCTCCGTTGCTATGGATGCAGGC
CATTCGTCCTTCCAGTTCTACAAATCAGGCATTTATTTTGAACCAGACTGCAGCAGCAAAAACCTGGAT
CATGGTGTTCTGGTGGTTGGCTACGGCTTTGAAGGAGCAAATTCGAATAACAGCAAGTATTGGCTCGTC
AAAAACAGCTGGGGTCCAGAATGGGGCTCGAATGGCTATGTAAAAATAGCCAAAGACAAGAACAACCAC
TGTGGAATCGCCACAGCAGCCAGCTACCCCAATGTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001201575
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201575.1
RefSeq Size 4339 bp
RefSeq ORF 1005 bp
Locus ID 1515
UniProt ID O60911
Protein Families Druggable Genome, Protease
Protein Pathways Lysosome
MW 37.3 kDa
Gene Summary The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may play an important role in corneal physiology. This gene is expressed in colorectal and breast carcinomas but not in normal colon, mammary gland, or peritumoral tissues, suggesting a possible role for this gene in tumor processes. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...