CAPZB (NM_001206540) Human Untagged Clone

CAT#: SC329816

CAPZB (untagged) - Homo sapiens capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 2



  "NM_001206540" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal antibody to CAPZB (capping protein (actin filament) muscle Z-line, beta)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAPB; CAPPB; CAPZ
Vector pCMV6-Entry
Sequence Data
>SC329816 representing NM_001206540.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTGATCAGCAGCTGGACTGTGCCTTGGACCTAATGAGGCGCCTGCCTCCCCAGCAAATCGAGAAA
AACCTCAGCGACCTGATCGACCTGGTCCCCAGTCTATGTGAGGATCTCCTGTCTTCTGTTGACCAGCCA
CTGAAAATTGCCAGAGACAAGGTGGTGGGAAAGGATTACCTTTTGTGTGACTACAACAGAGATGGGGAC
TCCTATAGGTCACCATGGAGTAACAAGTATGACCCTCCCTTGGAGGATGGGGCCATGCCGTCAGCTCGG
CTGAGAAAGCTGGAGGTGGAAGCCAACAATGCCTTTGACCAGTATCGAGACCTGTATTTTGAAGGTGGC
GTCTCATCTGTCTACCTCTGGGATCTGGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAGGCTGGA
GATGGATCAAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTAGAAGTGCAGGAGAAATCCAGC
GGTCGCACCGCCCATTACAAGTTGACCTCCACGGTGATGCTGTGGCTGCAGACCAACAAATCTGGCTCT
GGCACCATGAACCTCGGAGGCAGCCTTACCAGACAGATGGAGAAGGATGAAACTGTGAGTGACTGCTCC
CCACACATAGCCAACATCGGGCGCCTGGTAGAGGACATGGAAAATAAAATCAGAAGTACGCTGAACGAG
ATCTACTTTGGAAAAACAAAGGATATCGTCAATGGGCTGAGATCTATTGATGCTATCCCTGACAACCAA
AAGTTTAAGCAGTTGCAGAGGGAGCTCTCTCAAGTGCTGACCCAGCGCCAGATCTACATCCAGCCTGAT
AATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001206540
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206540.2
RefSeq Size 1910 bp
RefSeq ORF 834 bp
Locus ID 832
UniProt ID P47756
MW 31.4 kDa
Gene Summary This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. A pseudogene of this gene is located on the long arm of chromosome 2. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) has an additional exon in the 3' region, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a longer and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...