DLST (NM_001244883) Human Untagged Clone
CAT#: SC330226
DLST (untagged) - Homo sapiens dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 2
CNY 2950.00
Product images

CNY 6281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DLTS; KGD2; PGL7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330226 representing NM_001244883.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCTGTCCCGATCCCGCTGTGTGTCTCGGGCGTTCAGCCGCTCGCTCTCCGCCTTCCAGAAGGGGAAC TGCCCTCTAGGGAGACGTTCCCTGCCTGGGGTCTCCTTATGCCAGGGACCAGGTTACCCTAACAGCAGG AAGGTTGTCATTAACAACAGTGTCTTCAGTGTTCGCTTTTTCAGAACTACAGCTGTATGCAAGGATGAC TTGGTTACAGTCAAAACCCCAGCGTTTGCAGAATCTGTCACAGAGGGAGATGTCAGGTGGGAGAAAGCT GTTGGAGACACAGTTGCAGAAGATGAAGTGGTTTGTGAGATTGAAACTGACAAGACATCTGTGCAGGTT CCATCACCAGCAAATGGCGTGATTGAAGCTCTTTTGGTACCTGATGGGGGAAAAGTCGAAGGAGGCACT CCACTTTTCACACTCAGGAAAACTGGTGGTAAAGAAGTTCTCCTGGTGGTCAAGGTCTCCAGTGTTCCC TCTTGGGATTGGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244883 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001244883.1 |
RefSeq Size | 1229 bp |
RefSeq ORF | 501 bp |
Locus ID | 1743 |
Protein Pathways | Citrate cycle (TCA cycle), Lysine degradation, Metabolic pathways |
MW | 17.9 kDa |
Gene Summary | This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231932 | DLST (Myc-DDK tagged) - Homo sapiens dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 2 |
CNY 1200.00 |
|
RG231932 | DLST (tGFP-tagged) - Homo sapiens dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 2 |
CNY 4370.00 |