AP4S1 (NM_001254729) Human Untagged Clone
CAT#: SC330321
AP4S1 (untagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 6
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AP47B; CLA20; CLAPS4; CPSQ6; SPG52 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330321 representing NM_001254729.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATAAAATTTTTCCTCATGGTGAATAAACAAGGGCAGACTCGACTTTCTAAGTACTATGAACATGTG GATATTAATAAGCGTACACTTCTGGAAACAGAAGTCATAAAGAGCTGTCTCTCTCGATCCAATGAACAA TGCTCTTTCATTGAATATAAGGATTTTAAGCTGATATATCGGCAGTATGCAGCTCTCTTCATTGTGGTT GGAGTTAATGACACTGAGAACGAGATGGCTATTTATGAATTCATTCATAACTTTGTGGAAGTTTTAGAT GAGTATTTCAGCCGAGTGAGTGAATTAGATATAATGTTTAATTTGGATAAAGTACACATCATTTTGGAT GAGATGGTGTTAAATGGCTGCATTGTGGAAACTAACAGGGCAAGAATTCTTGCCCCTCTACTAATTCTT GATAAGATGTCAGAAAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001254729 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001254729.1 |
RefSeq Size | 4135 bp |
RefSeq ORF | 435 bp |
Locus ID | 11154 |
UniProt ID | Q9Y587 |
Protein Pathways | Lysosome |
MW | 17 kDa |
Gene Summary | This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (6) differs in the 5' UTR, uses an alternate splice site in the 3' coding region and has an alternate terminal exon, compared to variant 1. Variants 2, 5 and 6 encode the same isoform (2), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231817 | AP4S1 (Myc-DDK tagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 6 |
CNY 1200.00 |
|
RG231817 | AP4S1 (tGFP-tagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 6 |
CNY 4370.00 |