ALIX (PDCD6IP) (NM_001256192) Human Untagged Clone
CAT#: SC330382
PDCD6IP (untagged) - Homo sapiens programmed cell death 6 interacting protein (PDCD6IP), transcript variant 4
CNY 2950.00
货期*
4周
规格
Product images
推荐一起购买 (3)
PDCD6IP mouse monoclonal antibody, clone OTI1A4 (formerly 1A4)
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIP1; ALIX; DRIP4; HP95 |
| Vector | pCMV6-Entry |
| Sequence Data |
>SC330382 representing NM_001256192.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGACATTCATCTCGGTGCAGCTGAAAAAGACCTCAGAGGTGGACCTGGCCAAGCCGCTGGTGAAG TTCATCCAGCAGACTTACCCAAGCGGCGGGGAAGAGCAGGCCCAGTACTGCCGCGCGGCGGAGGAGCTC AGCAAGCTGCGCCGCGCCGCAGTCGGTCGTCCGCTGGACAAGCACGAGGGCGCGCTCGAGACGCTCCTG AGATATTATGATCAGATTTGTTCTATTGAACCCAAATTCCCATTTTCTGAAAATCAGATCTGCTTGACA TTTACCTGGAAGGATGCTTTCGATAAAGGTTCACTTTTTGGAGGCTCTGTAAAACTGGCTCTTGCAAGC TTAGGATATGAAAAGAGCTGTGTGTTGTTCAATTGTGCAGCCTTAGCTAGCCAAATTGCAGCAGAACAG AACCTGGATAATGATGAAGGATTGAAAATCGCTGCTAAACATTACCAGTTTGCTAGTGGTGCCTTTTTA CATATTAAAGAGACGGTTTTATCTGCCTTAAGTCGAGAGCCGACCGTGGACATATCTCCAGATACTGTT GGGACCCTCAGTCTTATTATGCTGGCACAGGCTCAAGAAGTATTTTTTTTAAAAGCCACAAGAGATAAA ATGAAAGATGCCATCATAGCTAAATTGGCTAATCAGGCTGCAGATTATTTTGGTGATGCTTTCAAACAG TGTCAATACAAAGATACTCTCCCCAAGGTCAGTTATTGTTTTTATAAACACTTGCTTACTTTGCATGTG AAATATTTAGACTTTTTTGTGTATAAGAAGCAAGTTGAAACTTATAAAGAAATTTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001256192 |
| Insert Size | 816 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001256192.1 |
| RefSeq Size | 1569 bp |
| RefSeq ORF | 816 bp |
| Locus ID | 10015 |
| UniProt ID | Q8WUM4 |
| Protein Families | Druggable Genome |
| Protein Pathways | Endocytosis |
| MW | 30.5 kDa |
| Gene Summary | This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 2. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
Customer
Reviews
Loading...
