PTGES2 (NM_001256335) Human Untagged Clone

CAT#: SC330397

PTGES2 (untagged) - Homo sapiens prostaglandin E synthase 2 (PTGES2), transcript variant 5



  "NM_001256335" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PTGES2 mouse monoclonal antibody, clone OTI2C3 (formerly 2C3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C9orf15; GBF-1; GBF1; mPGES-2; PGES2
Vector pCMV6-Entry
Sequence Data
>SC330397 representing NM_001256335.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGGCTGTGAACGAGCAGGGCAAGGAGGTGACCGAGTTCGGCAATAAGTACTGGCTCATGCTCAAC
GAGAAGGAGGCCCAGCAAGTGTATGGTGGGAAGGAGGCCAGGACGGAGGAGATGAAGTGGCGGCAGTGG
GCGGACGACTGGCTGGTGCACCTGATCTCCCCCAATGTGTACCGCACGCCCACCGAGGCTCTGGCGTCC
TTTGACTACATTGTCCGCGAGGGCAAGTTCGGAGCCGTGGAGGGTGCCGTGGCCAAGTACATGGGTGCA
GCGGCCATGTACCTCATCAGCAAGCGACTCAAGAGCAGGCACCGCCTCCAGGACAACGTGCGCGAGGAC
CTCTATGAGGCTGCTGACAAGTGGGTGGCTGCTGTGGGCAAGGACCGGCCCTTCATGGGGGGCCAGAAG
CCGAATCTCGCTGATTTGGCGGTGTATGGCGTGCTGCGTGTGATGGAGGGGCTGGATGCGTTCGATGAC
CTGATGCAGCACACGCACATCCAGCCCTGGTACCTGCGGGTGGAGAGGGCCATCACCGAGGCCTCCCCA
GCGCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256335
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256335.1
RefSeq Size 1369 bp
RefSeq ORF 561 bp
Locus ID 80142
UniProt ID Q9H7Z7
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
MW 21.3 kDa
Gene Summary The protein encoded by this gene is a membrane-associated prostaglandin E synthase, which catalyzes the conversion of prostaglandin H2 to prostaglandin E2. This protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE). Multiple transcript variants have been found for this gene. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 5 encode isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...