G protein alpha inhibitor 1 (GNAI1) (NM_001256414) Human Untagged Clone

CAT#: SC330422

GNAI1 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), transcript variant 2



  "NM_001256414" in other vectors (2)

CNY 2,640.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
GNAI1 mouse monoclonal antibody,clone OTI2D1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Gi
Vector pCMV6-Entry
Sequence Data
>SC330422 representing NM_001256414.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAATTATCCATGAAGCTGGTTATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGT
AACACCATCCAGTCAATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCA
GCCCGGGCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACTGCA
GAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTCAACAGATCCCGA
GAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGACAGAATAGCTCAACCAAATTAC
ATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAAACTACAGGAATTGTTGAAACCCATTTTACT
TTCAAAGATCTTCATTTTAAAATGTTTGATGTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCAT
TGCTTCGAAGGAGTGACGGCGATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAA
GATGAAGAAATGAACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTT
ACAGATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAGAGCCCT
CTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCTGCATATATTCAATGT
CAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATACACCCACTTCACATGTGCCACAGAT
ACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACAGATGTCATCATAAAAAATAATCTAAAAGATTGT
GGTCTCTTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256414
Insert Size 909 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256414.1
RefSeq Size 3181 bp
RefSeq ORF 909 bp
Locus ID 2770
UniProt ID P63096
Protein Families Druggable Genome
Protein Pathways Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction
MW 34.8 kDa
Gene Summary Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它G protein alpha inhibitor 1产品

Customer Reviews 
Loading...