CYRIB (NM_001256763) Human Untagged Clone

CAT#: SC330516

FAM49B (untagged) - Homo sapiens family with sequence similarity 49, member B (FAM49B), transcript variant 1



  "NM_001256763" in other vectors (2)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-FAM49B Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BM-009; CYRI; CYRI-B; FAM49B; L1
Vector pCMV6-Entry
Sequence Data
>SC330516 representing NM_001256763.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTT
GAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCA
GAAGGCATCTTGGAGGACTTGCAGTCATACAGAGGAGCTGGCCACGAAATACGAGAGGCAATCCAGCAT
CCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTCCACTAGTAGGCAAATTAAAGAAA
TTTTACGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCCTTAACAAGTACCCCA
TATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTC
ACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTATAGAAGA
ACATTGAGTCGTATGAGGATTAACAATGTACCGGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCA
AATCGAATGTCTTTGTTTTATGCTGAGGCAACTCCAATGCTGAAAACCTTGAGTGATGCCACAACAAAA
TTTGTATCAGAGAATAAAAATTTACCAATAGAAAATACCACAGATTGTTTAAGCACAATGGCTAGTGTA
TGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGC
TTGAGGGTAATGGTGGGTGTCATAATACTCTATGACCACGTACATCCAGTGGGAGCATTTGCTAAAACT
TCCAAAATTGATATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTGTGGAAGGTCTT
CTAAATGCTCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATG
CTGCAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256763
Insert Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256763.1
RefSeq Size 3925 bp
RefSeq ORF 975 bp
Locus ID 51571
UniProt ID Q9NUQ9
MW 36.7 kDa
Gene Summary Negatively regulates RAC1 signaling and RAC1-driven cytoskeletal remodeling (PubMed:31285585, PubMed:30250061). Regulates chemotaxis, cell migration and epithelial polarization by controlling the polarity, plasticity, duration and extent of protrusions. Limits Rac1 mediated activation of the Scar/WAVE complex, focuses protrusion signals and regulates pseudopod complexity by inhibiting Scar/WAVE-induced actin polymerization (PubMed:30250061). Protects against Salmonella bacterial infection. Attenuates processes such as macropinocytosis, phagocytosis and cell migration and restrict sopE-mediated bacterial entry (PubMed:31285585). Restricts also infection mediated by Mycobacterium tuberculosis and Listeria monocytogenes (By similarity). Involved in the regulation of mitochondrial dynamics and oxidative stress (PubMed:29059164).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) and variant 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...