RPS3 (NM_001256802) Human Untagged Clone

CAT#: SC330522

RPS3 (untagged) - Homo sapiens ribosomal protein S3 (RPS3), transcript variant 2



  "NM_001256802" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-RPS3 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms S3
Vector pCMV6-Entry
Sequence Data
>SC330522 representing NM_001256802.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAATGAG
TTTCTTACTCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAGGTGCGAGTTACACCAACCAGGACA
GAAATCATTATCTTAGCCACCAGAACACAGAATGTTCTTGGTGAGAAGGGCCGGCGGATTCGGGAACTG
ACTGCTGTAGTTCAGAAGAGGTTTGGCTTTCCAGAGGGCAGTGTAGAGCTTTATGCTGAAAAGGTGGCC
ACTAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTGCGTTACAAACTCCTAGGAGGGCTTGCTGTG
CGGAGGGCCTGCTATGGTGTGCTGCGGTTCATCATGGAGAGTGGGGCCAAAGGCTGCGAGGTTGTGGTG
TCTGGGAAACTCCGAGGACAGAGGGCTAAATCCATGAAGTTTGTGGATGGCCTGATGATCCACAGCGGA
GACCCTGTTAACTACTACGTTGACACTGCTGTGCGCCACGTGTTGCTCAGACAGGGTGTGCTGGGCATC
AAGGTGAAGATCATGCTGCCCTGGGACCCAACTGGTAAGATTGGCCCTAAGAAGCCCCTGCCTGACCAC
GTGAGCATTGTGGAACCCAAAGATGAGATACTGCCCACCACCCCCATCTCAGAACAGAAGGGTGGGAAG
CCAGAGCCGCCTGCCATGCCCCAGCCAGTCCCCACAGCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256802
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256802.1
RefSeq Size 1382 bp
RefSeq ORF 732 bp
Locus ID 6188
UniProt ID P23396
Protein Pathways Ribosome
MW 26.7 kDa
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...