KCTD1 (NM_001258221) Human Untagged Clone

CAT#: SC330646

KCTD1 (untagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 4



  "NM_001258221" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KCTD1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C18orf5
Vector pCMV6-Entry
Sequence Data
>SC330646 representing NM_001258221.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACAACCAAGGCATCCCTACTCCAGCA
CAACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCACATGTACACCAGCAGCCTGGCC
ACCCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGTACAGAGCCCATTGTTTTGGAC
AGTCTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGATATATCTTGAATTTTCTACGA
ACATCCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATATGAAGAGGCAAAATATTTT
CAGCTTCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAAACTGGTCGATTTTCAAGG
CCCTGTGAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCACGCTAAGCGGTGACAAA
TCCTTGATAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGTCAATGCAGGCTGGAAT
CACGACTCGACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAACTCAGTCCAGGTCCTC
GAGAGGTTGCAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAGACTCGTCCCAGTTC
AGCGAATACGTCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCATCCGGATAAAGCAA
GAGCCTCTGGACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001258221
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258221.1
RefSeq Size 1715 bp
RefSeq ORF 774 bp
Locus ID 284252
UniProt ID Q719H9
Protein Families Ion Channels: Other
MW 29.4 kDa
Gene Summary This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 3. Variants 1, 2, 4 and 6 all encode the same isoform (a), which has a shorter N-terminus compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...