glucose 6 phosphatase, catalytic subunit (G6PC) (NM_001270397) Human Untagged Clone

CAT#: SC330823

G6PC (untagged) - Homo sapiens glucose-6-phosphatase, catalytic subunit (G6PC), transcript variant 2



  "NM_001270397" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-G6PC Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G6Pase; G6PC; G6PT; GSD1; GSD1a
Vector pCMV6-Entry
Sequence Data
>SC330823 representing NM_001270397.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGAAGGAATGAATGTTCTCCATGACTTTGGGATCCAGTCAACACATTACCTCCAGGTGAATTAC
CAAGACTCCCAGGACTGGTTCATCTTGGTGTCCGTGATCGCAGACCTCAGGAATGCCTTCTACGTCCTC
TTCCCCATCTGGTTCCATCTTCAGGAAGCTGTGGGCATTAAACTCCTTTGGGTAGCTGTGATTGGAGAC
TGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACAGCGTCCATACTGGTGGGTTTTGGATACTGAC
TACTACAGCAACACTTCCGTGCCCCTGATAAAGCAGTTCCCTGTAACCTGTGAGACTGGACCAGGGAAA
GATAAAGCCGACCTACAGATTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGGCTGTGCAGCT
GAATGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTTCCTCATCAAGTTGTTGCTGGAGTCCTGTC
AGGCATTGCTGTTGCAGAAACTTTCAGCCACATCCACAGCATCTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001270397
Insert Size 531 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270397.1
RefSeq Size 4092 bp
RefSeq ORF 531 bp
Locus ID 2538
UniProt ID P35575
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Adipocytokine signaling pathway, Galactose metabolism, Glycolysis / Gluconeogenesis, Insulin signaling pathway, Metabolic pathways, Starch and sucrose metabolism
MW 20.2 kDa
Gene Summary Glucose-6-phosphatase (G6Pase) is a multi-subunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for G6P, inorganic phosphate, and glucose. This gene (G6PC) is one of the three glucose-6-phosphatase catalytic-subunit-encoding genes in human: G6PC, G6PC2 and G6PC3. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). This disease, also known as von Gierke disease, is a metabolic disorder characterized by severe hypoglycemia associated with the accumulation of glycogen and fat in the liver and kidneys.[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) lacks an internal segment in the coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它glucose 6 phosphatase, catalytic subunit产品

Customer Reviews 
Loading...