KCNE1 (NM_001270405) Human Untagged Clone
CAT#: SC330827
KCNE1 (untagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK |
Vector | pCMV6-Entry |
Sequence Data |
>SC330827 representing NM_001270405.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATCCTGTCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACAGTTCAGCAG GGTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGCAAGCTGGAGGCCCTCTAC GTCCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGCATCATGCTGAGCTACATCCGCTCCAAG AAGCTGGAGCACTCGAACGACCCATTCAACGTCTACATCGAGTCCGATGCCTGGCAAGAGAAGGACAAG GCCTATGTCCAGGCCCGGGTCCTGGAGAGCTACAGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATA GAACAACCCAACACACACCTTCCTGAGACGAAGCCTTCCCCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270405 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001270405.1 |
RefSeq Size | 3151 bp |
RefSeq ORF | 390 bp |
Locus ID | 3753 |
UniProt ID | P15382 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
MW | 14.7 kDa |
Gene Summary | The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) differs in the 5' UTR, compared to variant 2. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231748 | KCNE1 (Myc-DDK tagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8 |
CNY 1200.00 |
|
RG231748 | KCNE1 (tGFP-tagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8 |
CNY 4370.00 |