PSMD11 (NM_001270482) Human Untagged Clone

CAT#: SC330848

PSMD11 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (PSMD11), transcript variant 1



  "NM_001270482" in other vectors (2)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PSMD11 Antibody
    • 100 ug

CNY 4381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p44.5; Rpn6; S9
Vector pCMV6-Entry
Sequence Data
>SC330848 representing NM_001270482.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCGGCGGCGGTGGTGGAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGACCGGGAGGCCTCC
ATCGACATCCTCCACTCCATCGTGAAGCGTGACATTCAGGAAAACGATGAAGAGGCAGTGCAAGTCAAA
GAGCAGAGCATCCTGGAACTGGGATCTCTCCTGGCAAAGACTGGACAAGCTGCAGAGCTTGGAGGACTC
CTGAAGTATGTACGACCCTTCTTGAATTCCATCAGCAAGGCTAAAGCAGCTCGCCTGGTCCGATCTCTT
CTTGATCTGTTTCTTGATATGGAAGCAGCTACAGGGCAGGAGGTCGAGCTGTGTTTAGAGTGCATCGAA
TGGGCCAAGTCAGAGAAAAGAACTTTCTTACGCCAAGCTTTGGAGGCAAGACTGGTGTCTTTGTACTTT
GATACCAAGAGGTACCAGGAAGCATTGCATTTGGGTTCTCAGCTGCTGCGGGAGTTGAAAAAGATGGAC
GACAAAGCTCTTTTGGTGGAAGTACAGCTTTTAGAAAGCAAAACATACCATGCCCTGAGCAACCTGCCG
AAAGCCCGAGCTGCCTTAACTTCTGCTCGAACCACAGCAAATGCCATCTACTGCCCCCCTAAATTGCAG
GCCACCTTGGACATGCAGTCGGGTATTATCCATGCAGCAGAAGAGAAGGACTGGAAAACTGCGTACTCA
TACTTCTATGAGGCATTTGAGGGTTATGACTCCATCGACAGCCCCAAGGCCATCACATCTCTGAAGTAC
ATGTTGCTGTGCAAAATCATGCTCAACACCCCAGAAGATGTCCAGGCTTTGGTGAGCGGGAAGCTTGCA
CTTCGGTATGCAGGGAGGCAGACAGAAGCATTAAAATGCGTGGCTCAGGCTAGCAAGAACAGATCACTG
GCAGATTTTGAAAAGGCTCTGACAGATTACCGGGCAGAGCTCCGGGATGACCCAATCATCAGCACACAC
TTGGCCAAGTTGTATGATAACTTACTAGAACAGAATCTGATCCGAGTCATTGAGCCTTTTTCCAGAGTA
CAGATTGAACACATATCTAGTCTCATCAAACTCTCCAAGGCCGACGTGGAAAGGAAATTATCACAGATG
ATTCTTGACAAGAAATTTCATGGGATTTTGGACCAGGGGGAGGGTGTCCTGATTATTTTCGATGAACCC
CCAGTAGATAAAACTTACGAAGCTGCTCTGGAAACAATTCAGAACATGAGCAAAGTAGTGGATTCCCTC
TACAACAAAGCCAAGAAACTGACATAG

Restriction Sites SgfI-MluI     
ACCN NM_001270482
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270482.1
RefSeq Size 4035 bp
RefSeq ORF 1269 bp
Locus ID 5717
UniProt ID O00231
Protein Families Stem cell - Pluripotency
Protein Pathways Proteasome
MW 47.5 kDa
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...