SESN3 (NM_001271594) Human Untagged Clone

CAT#: SC330943

SESN3 (untagged) - Homo sapiens sestrin 3 (SESN3), transcript variant 2



  "NM_001271594" in other vectors (2)

CNY 3420.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal antibody to SESN3 (sestrin 3)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SEST3
Vector pCMV6-Entry
Sequence Data
>SC330943 representing NM_001271594.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTTTACACACTCAGTACCTGGAGTCTTTCTTGCGGAGCCAGTTTTACATGTTGCGCATGGATGGT
CCCCTTCCTCTACCATACAGGCACTATATTGCAATAATGAAACTTGTCAAAACTGGAGAAAATAATTGG
TCTCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTT
GGTAGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAAT
TTCTGCGTTTGTGATCTTGCTAATGACAACAACATAGAGAATGCATCTCTTTCAGGCAGCAACTTTGGG
ATTGTGGATTCTCTAAGTGAGCTAGAGGCCTTAATGGAAAGGATGAAAAGACTTCAAGAAGAAAGGGAA
GATGAAGAGGCGTCTCAAGAAGAAATGAGCACTCGTTTTGAAAAGGAGAAGAAAGAAAGTCTTTTTGTG
GTCTCTGGAGATACTTTTCATTCATTTCCTCATTCAGATTTTGAGGATGACATGATTATAACATCTGAT
GTCTCTCGATATATTGAAGACCCTGGTTTTGGGTATGAAGACTTTGCCAGACGAGGAGAAGAGCATTTG
CCAACATTCCGAGCTCAGGACTATACCTGGGAAAATCATGGGTTCTCCCTGGTGAACAGACTTTATTCT
GACATTGGACATCTTCTTGATGAAAAGTTTCGGATGGTCTACAATCTCACATATAACACTATGGCCACC
CATGAGGATGTTGACACAACCATGCTGCGCAGAGCTTTATTTAACTATGTTCACTGTATGTTTGGAATC
AGGTATGATGACTATGATTATGGAGAAGTTAATCAATTACTTGAAAGAAGCCTGAAGGTTTACATTAAG
ACAGTGACCTGCTATCCTGAGAGAACTACAAAACGCATGTATGATAGTTACTGGCGGCAGTTCAAACAC
TCAGAAAAAGTTCATGTCAATCTACTTTTAATGGAAGCACGAATGCAAGCTGAACTTCTTTATGCTCTT
CGTGCCATAACTCGGCATTTGACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271594
Insert Size 1062 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271594.1
RefSeq Size 9345 bp
RefSeq ORF 1062 bp
Locus ID 143686
UniProt ID P58005
Protein Pathways p53 signaling pathway
MW 41.5 kDa
Gene Summary This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate in-frame splice site compared to variant 1. It encodes a shorter protein (isoform 2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...