DBNDD2 (NM_001197139) Human Untagged Clone
CAT#: SC331197
DBNDD2 (untagged) - Homo sapiens dysbindin (dystrobrevin binding protein 1) domain containing 2 (DBNDD2), transcript variant 7
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf35; CK1BP; HSMNP1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331197 representing NM_001197139.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACCCAAATCCTCGGGCCGCCCTGGAGCGCCAGCAGCTCCGCCTTCGGGAGCGGCAAAAATTCTTC GAGGACATTTTACAGCCAGAGACAGAGTTTGTCTTTCCTCTGTCCCATCTGCATCTCGAGTCGCAGAGA CCCCCCATAGGTAGTATCTCATCCATGGAAGTGAATGTGGACACACTGGAGCAAGTAGAACTTATTGAC CTTGGGGACCCGGATGCAGCAGATGTGTTCTTGCCTTGCGAAGATCCTCCACCAACCCCCCAGTCGTCT GGGATGGACAACCATTTGGAGGAGCTGAGCCTGCCGGTGCCTACATCAGACAGGACCACATCTAGGACC TCCTCCTCCTCCTCCTCCGACTCCTCCACCAACCTGCATAGCCCAAATCCAAGTGATGATGGAGCAGAT ACGCCCTTGGCACAGTCGGATGAAGAGGAGGAAAGGGGTGATGGAGGGGCAGAGCCTGGAGCCTGCAGC TAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001197139 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001197139.1 |
RefSeq Size | 998 bp |
RefSeq ORF | 486 bp |
Locus ID | 55861 |
UniProt ID | Q9BQY9 |
MW | 17.5 kDa |
Gene Summary | May modulate the activity of casein kinase-1. Inhibits CSNK1D autophosphorylation (in vitro).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (7) differs in the 5' UTR compared to variant 1. Variants 1, 5, 7 and 8 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233331 | DBNDD2 (Myc-DDK tagged) - Homo sapiens dysbindin (dystrobrevin binding protein 1) domain containing 2 (DBNDD2), transcript variant 7 |
CNY 1200.00 |
|
RG233331 | DBNDD2 (tGFP-tagged) - Homo sapiens dysbindin (dystrobrevin binding protein 1) domain containing 2 (DBNDD2), transcript variant 7 |
CNY 4370.00 |