MLC1SA (MYL6B) (NM_001199629) Human Untagged Clone
CAT#: SC331332
MYL6B (untagged) - Homo sapiens myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 1
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MLC1SA |
Vector | pCMV6-Entry |
Sequence Data |
>SC331332 representing NM_001199629.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCTCCCAAGAAGGATGTTCCCGTGAAGAAACCAGCAGGGCCCTCCATCTCCAAACCTGCTGCTAAG CCAGCAGCAGCAGGGGCTCCTCCAGCCAAGACCAAAGCTGAGCCAGCTGTCCCCCAGGCCCCTCAGAAA ACCCAGGAGCCTCCAGTCGATCTCTCCAAAGTGGTGATCGAGTTTAACAAGGACCAGCTGGAGGAGTTC AAGGAGGCCTTCGAGCTGTTTGACCGAGTGGGGGATGGCAAGATCCTGTACAGCCAGTGTGGGGACGTG ATGAGGGCCCTGGGCCAGAACCCCACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGAT GAGCTGAAGTCGCGGCGTGTGGACTTTGAGACTTTCCTGCCCATGCTCCAGGCAGTGGCCAAGAACCGA GGCCAAGGCACATATGAGGACTACTTGGAGGGGTTTCGTGTGTTTGACAAGGAGGGGAACGGCAAAGTC ATGGGAGCAGAGCTCAGACATGTTCTCACCACCCTTGGAGAGAAGATGACTGAGGAGGAGGTGGAGACC GTTCTGGCAGGACACGAGGACAGCAACGGCTGCATCAACTACGAGGCCTTCTTGAAACACATCCTAAGC GTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199629 |
Insert Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199629.1 |
RefSeq Size | 1072 bp |
RefSeq ORF | 627 bp |
Locus ID | 140465 |
UniProt ID | P14649 |
Protein Pathways | Vascular smooth muscle contraction |
MW | 22.8 kDa |
Gene Summary | Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233437 | MYL6B (Myc-DDK tagged) - Homo sapiens myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 1 |
CNY 2400.00 |
|
RG233437 | MYL6B (tGFP-tagged) - Homo sapiens myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 1 |
CNY 4370.00 |