OTX1 (NM_001199770) Human Untagged Clone

CAT#: SC331358

OTX1 (untagged) - Homo sapiens orthodenticle homeobox 1 (OTX1), transcript variant 2



  "NM_001199770" in other vectors (2)

CNY 3420.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


OTX1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331358 representing NM_001199770.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGTCTTACCTCAAACAACCCCCATACGGCATGAACGGGCTGGGCCTGGCCGGGCCCGCCATGGAC
CTCCTGCACCCATCCGTGGGCTATCCGGCCACTCCGCGGAAGCAGCGGCGGGAGCGCACCACCTTCACG
CGTTCACAGCTGGACGTGCTCGAGGCGCTCTTCGCCAAGACTCGCTACCCTGACATCTTCATGCGGGAG
GAGGTGGCGCTCAAGATCAACCTGCCGGAGTCTAGAGTCCAGGTCTGGTTCAAGAACCGCCGCGCCAAA
TGCCGCCAGCAGCAGCAGAGCGGGAGCGGAACCAAGAGCCGCCCAGCCAAGAAGAAGTCCTCTCCAGTG
CGGGAGAGCTCGGGCTCCGAAAGCAGTGGCCAATTCACGCCGCCAGCTGTGTCCAGCTCTGCCTCGTCC
TCTAGCTCGGCGTCCAGCTCTTCCGCCAACCCAGCGGCTGCAGCGGCTGCGGGACTAGGTGGGAACCCG
GTGGCGGCCGCGTCGTCGCTGAGTACACCAGCTGCCTCATCTATCTGGAGCCCGGCCTCCATCTCGCCA
GGCTCAGCGCCCGCGTCCGTGTCGGTGCCGGAGCCATTGGCCGCGCCTAGCAACACCTCGTGTATGCAG
CGCTCCGTAGCTGCAGGCGCCGCCACCGCAGCAGCCTCTTATCCCATGTCCTACGGCCAGGGCGGCAGC
TACGGCCAAGGCTACCCTACGCCCTCCTCTTCCTACTTTGGCGGCGTGGACTGCAGCTCATACCTAGCG
CCCATGCACTCACATCACCACCCGCACCAGCTCAGCCCCATGGCACCCTCCTCCATGGCGGGCCACCAT
CATCACCACCCACATGCGCACCACCCGTTGAGCCAGTCCTCAGGCCACCACCACCACCATCACCACCAC
CACCACCAAGGCTACGGTGGCTCTGGGCTTGCCTTCAACTCTGCCGACTGCTTGGATTACAAGGAGCCT
GGCGCCGCTGCTGCTTCCTCCGCCTGGAAACTCAACTTCAACTCCCCCGACTGTCTGGACTATAAGGAC
CAAGCCTCATGGCGGTTCCAGGTCTTGTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001199770
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199770.1
RefSeq Size 2872 bp
RefSeq ORF 1065 bp
Locus ID 5013
UniProt ID P32242
Protein Families Druggable Genome, Transcription Factors
MW 37.3 kDa
Gene Summary This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. A similar protein in mouse is required for proper brain and sensory organ development and can cause epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...