PLA1A (NM_001206961) Human Untagged Clone

CAT#: SC331722

PLA1A (untagged) - Homo sapiens phospholipase A1 member A (PLA1A), transcript variant 3



  "NM_001206961" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal PLA1A Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PS-PLA1; PSPLA1
Vector pCMV6-Entry
Sequence Data
>SC331722 representing NM_001206961.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGGACAGCTCTTCGGAGGCCAGCTGGGACAGATCACAGGCCTGGACCCCGCTGGACCTGAGTAC
ACCAGGGCCAGTGTGGAAGAGCGCTTGGATGCTGGAGATGCCCTCTTCGTGGAAGCCATCCACACAGAC
ACCGACAATTTGGGTATTCGGATTCCCGTTGGACATGTGGACTACTTCGTCAACGGAGGCCAAGACCAA
CCTGGCTGCCCCACCTTCTTTTACGCAGGTTATAGTTATCTGATCTGTGATCACATGAGGGCTGTGCAC
CTCTACATCAGCGCCCTGGAGAATTCCTGTCCACTGATGGCCTTTCCCTGTGCCAGCTACAAGGCCTTC
CTTGCTGGACGCTGTCTGGATTGCTTTAACCCTTTTCTGCTTTCCTGCCCAAGGATAGGACTGGTGGAA
CAAGGTGGTGTCAAGATAGAGCCGCTCCCCAAGGAAGTGAAAGTCTACCTCCTGACTACTTCCAGTGCT
CCGTACTGCATGCATCACAGCCTCGTGGAGTTTCACTTGAAGGAACTGAGAAACAAGGACACCAACATC
GAGGTTACCTTCCTTAGCAGTAACATCACCTCTTCATCTAAGATCACCATACCTAAGCAGCAACGCTAT
GGGAAAGGAATCATAGCCCATGCCACCCCACAATGCCAGATAAACCAAGTGAAATTCAAGTTTCAGTCT
TCCAACCGAGTTTGGAAAAAAGACCGGACTACCATTATTGGGAAGTTCTGCACTGCCCTTTTGCCTGTC
AATGACAGAGAAAAGATGGTCTGCTTACCTGAACCAGTGAACTTACAAGCAAGTGTGACTGTTTCCTGT
GACCTGAAGATAGCCTGTGTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206961
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206961.1
RefSeq Size 1647 bp
RefSeq ORF 852 bp
Locus ID 51365
UniProt ID Q53H76
Protein Families Druggable Genome, Secreted Protein
MW 31.3 kDa
Gene Summary The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Transcript Variant: This variant (3) lacks an alternate coding exon compared to variant 1. The resulting isoform (3) uses a downstream AUG start site and is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...