ZNF444 (NM_001253792) Human Untagged Clone

CAT#: SC332227

ZNF444 (untagged) - Homo sapiens zinc finger protein 444 (ZNF444), transcript variant 2



  "NM_001253792" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ZNF444 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EZF-2; EZF2; ZSCAN17
Vector pCMV6-Entry
Sequence Data
>SC332227 representing NM_001253792.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGTGGCGGTGCCCGTGAAGCAGGAGGCCGAGGGCCTGGCGCTGGACTCCCCGTGGCACCGCTTC
CGCCGCTTCCACCTGGGCGACGCGCCGGGCCCGCGGGAGGCGCTGGGGCTGCTCCGCGCCCTGTGCCGG
GACTGGCTGCGGCCCGAGGTGCACACCAAGGAGCAGATGTTGGAGCTGCTGGTGCTGGAACAGTTCCTG
AGCGCGCTGCCCGCCGACACGCAGGCCTGGGTGTGCAGCCGGCAGCCGCAGAGCGGGGAGGAGGCGGTG
GCCCTGCTGGAGGAGCTCTGGGGGCCAGCAGCCTCCCCCGATGGGTCGTCAGCAACGAGGGTGCCTCAG
GATGTGACGCAGGGCCCTGGGGCCACAGGTGGAAAGGAGGACAGTGGGATGATTCCCTTAGGCACCGCC
CCTGGGGCTGAGGGGCCGGCGCCTGGGGACTCCCAGGCTGTGCGCCCCTACAAGCAGGAGCCCAGCAGC
CCCCCGCTGGCGCCTGGCCTGCCCGCCTTCCTAGCGGCCCCGGGCACCACGTCCTGCCCCGAGTGCGGC
AAAACGTCCCTGAAACCAGCTCACCTGCTGCGCCACCGGCAGAGCCACTCGGGCGAGAAGCCGCACGCC
TGCCCTGAGTGCGGGAAGGCCTTTCGGCGCAAGGAGCACCTGCGGCGCCACCGCGACACGCACCCCGGC
AGCCCCGGCAGCCCCGGGCCCGCGCTGCGCCCTCTGCCCGCCCGTGAGAAGCCCCACGCGTGCTGCGAG
TGTGGCAAGACCTTCTACTGGCGCGAGCACCTGGTGCGCCACCGCAAGACGCACTCGGGAGCGCGGCCC
TTTGCCTGCTGGGAGTGTGGCAAGGGCTTCGGGCGCCGCGAGCACGTGCTGCGCCACCAGCGCATCCAC
GGCCGGGCAGCGGCCAGCGCGCAGGGGGCGGTAGCTCCGGGCCCGGATGGTGGAGGCCCCTTCCCGCCC
TGGCCCTTGGGTTAG

Restriction Sites SgfI-RsrII     
ACCN NM_001253792
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253792.1
RefSeq Size 2061 bp
RefSeq ORF 981 bp
Locus ID 55311
UniProt ID Q8N0Y2
Protein Families Druggable Genome, Transcription Factors
MW 35.1 kDa
Gene Summary This gene encodes a zinc finger protein which activates transcription of a scavenger receptor gene involved in the degradation of acetylated low density lipoprotein (Ac-LDL) (PMID: 11978792). This gene is located in a cluster of zinc finger genes on chromosome 19 at q13.4. A pseudogene of this gene is located on chromosome 15. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...