CDCA8 (NM_001256875) Human Untagged Clone

CAT#: SC332493

CDCA8 (untagged) - Homo sapiens cell division cycle associated 8 (CDCA8), transcript variant 1



  "NM_001256875" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CDCA8 mouse monoclonal antibody, clone OTI4G3 (formerly 4G3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BOR; BOREALIN; DasraB; MESRGP
Vector pCMV6-Entry
Sequence Data
>SC332493 representing NM_001256875.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCCTAGGAAGGGCAGTAGTCGGGTGGCCAAGACCAACTCCTTACGGAGGCGGAAGCTCGCCTCC
TTTCTGAAAGACTTCGACCGTGAAGTGGAAATACGAATCAAGCAAATTGAGTCAGACAGGCAGAACCTC
CTCAAGGAGGTGGATAACCTCTACAACATCGAGATCCTGCGGCTCCCCAAGGCTCTGCGCGAGATGAAC
TGGCTTGACTACTTCGCCCTTGGAGGAAACAAACAGGCCCTGGAAGAGGCGGCAACAGCTGACCTGGAT
ATCACCGAAATAAACAAACTAACAGCAGAAGCTATTCAGACACCCCTGAAATCTGCCAAAACACGAAAG
GTAATACAGGTAGATGAAATGATAGTGGAAGAGGAAGAAGAAGAAGAAAATGAACGTAAGAATCTTCAA
ACTGCAAGAGTCAAAAGGTGTCCTCCATCCAAGAAGAGAACTCAGTCCATACAAGGAAAAGGAAAAGGG
AAAAGGTCAAGCCGTGCTAACACTGTTACCCCAGCCGTGGGCCGATTGGAGGTGTCCATGGTCAAACCA
ACTCCAGGCCTGACACCCAGGTTTGACTCAAGGGTCTTCAAGACCCCTGGCCTGCGTACTCCAGCAGCA
GGAGAGCGGATTTACAACATCTCAGGGAATGGCAGCCCTCTTGCTGACAGCAAAGAGATCTTCCTCACT
GTGCCAGTGGGCGGCGGAGAGAGCCTGCGATTATTGGCCAGTGACTTGCAGAGGCACAGTATTGCCCAG
CTGGATCCAGAGGCCTTGGGAAACATTAAGAAGCTCTCCAACCGTCTCGCCCAAATCTGCAGCAGCATA
CGGACCCACAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256875
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256875.1
RefSeq Size 2502 bp
RefSeq ORF 843 bp
Locus ID 55143
UniProt ID Q53HL2
Protein Families Druggable Genome
MW 31.3 kDa
Gene Summary This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...