HNRPH1 (HNRNPH1) (NM_001257293) Human Untagged Clone

CAT#: SC332522

HNRNPH1 (untagged) - Homo sapiens heterogeneous nuclear ribonucleoprotein H1 (H) (HNRNPH1), transcript variant 1



  "NM_001257293" in other vectors (2)

CNY 4370.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HNRNPH1 mouse monoclonal antibody,clone OTI4F10
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hnRNPH; HNRPH; HNRPH1
Vector pCMV6-Entry
Sequence Data
>SC332522 representing NM_001257293.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCG
GCCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATC
TACACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTG
GCCCTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAA
ATGGATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTT
AGAGGACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCA
AATGGGATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCA
CAGGAAATAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTT
AAGAGCAGTAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCA
GGTCCTTATGACAGACCTGGGGCTGGTAGAGGGTATAACAGCATTGGCAGAGGAGCTGGCTTTGAGAGG
ATGAGGCGTGGTGCTTATGGTGGAGGCTATGGAGGCTATGATGATTACAATGGCTATAATGATGGCTAT
GGATTTGGGTCAGATAGATTTGGAAGAGACCTCAATTACTGTTTTTCAGGAATGTCTGATCACAGATAC
GGGGATGGTGGCTCTACTTTCCAGAGCACAACAGGACACTGTGTACACATGCGGGGATTACCTTACAGA
GCTACTGAGAATGACATTTATAATTTTTTTTCACCGCTCAACCCTGTGAGAGTACACATTGAAATTGGT
CCTGATGGCAGAGTAACTGGTGAAGCAGATGTCGAGTTCGCAACTCATGAAGATGCTGTGGCAGCTATG
TCAAAAGACAAAGCAAATATGCAACACAGATATGTAGAACTCTTCTTGAATTCTACAGCAGGAGCAAGC
GGTGGTGCTTACGAACACAGATATGTAGAACTCTTCTTGAATTCTACAGCAGGAGCAAGCGGTGGTGCT
TATGGTAGCCAAATGATGGGAGGCATGGGCTTGTCAAACCAGTCCAGCTACGGGGGCCCAGCCAGCCAG
CAGCTGAGTGGGGGTTACGGAGGCGGCTACGGTGGCCAGAGCAGCATGAGTGGATACGACCAAGTTTTA
CAGGAAAACTCCAGTGATTTTCAATCAAACATTGCATAG

Restriction Sites SgfI-MluI     
ACCN NM_001257293
Insert Size 1350 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257293.1
RefSeq Size 2304 bp
RefSeq ORF 1350 bp
Locus ID 3187
UniProt ID P31943
MW 49.2 kDa
Gene Summary This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...