SERPINB6 (NM_001271825) Human Untagged Clone

CAT#: SC333124

SERPINB6 (untagged) - Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 6



  "NM_001271825" in other vectors (2)

CNY 3610.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SERPINB6 mouse monoclonal antibody, clone OTI1C5 (formerly 1C5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3
Vector pCMV6-Entry
Sequence Data
>SC333124 representing NM_001271825.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGTTCTCGCAGAAGCAAATGGCACCTTTGCCTTAAACCTTTTGAAAACGCTGGGTAAAGACAAC
TCGAAGAATGTGTTTTTCTCACCCATGAGCATGTCCTGTGCCCTGGCCATGGTCTACATGGGGGCAAAG
GGAAACACCGCTGCACAGATGGCCCAGATACTTTCTTTCAATAAAAGTGGCGGTGGTGGAGACATCCAC
CAGGGCTTCCAGTCTCTTCTCACCGAAGTGAACAAGACTGGCACGCAGTACTTGCTTAGGATGGCCAAC
AGGCTCTTTGGGGAAAAGTCTTGTGATTTCCTCTCATCTTTTAGAGATTCCTGCCAAAAATTCTACCAA
GCAGAGATGGAGGAGCTTGACTTTATCAGCGCCGTAGAGAAGTCCAGAAAACACATAAACACCTGGGTA
GCTGAAAAGACAGAAGGTAAAATTGCGGAGTTGCTCTCTCCGGGCTCAGTGGATCCATTGACAAGGCTG
GTTCTGGTGAATGCTGTCTATTTCAGAGGAAACTGGGATGAACAGTTTGACAAGGAGAACACCGAGGAG
AGACTGTTTAAAGTCAGCAAGAATGAGGAGAAACCTGTGCAAATGATGTTTAAGCAATCTACTTTTAAG
AAGACCTATATAGGAGAAATATTTACCCAAATCTTGGTGCTTCCATATGTTGGCAAGGAACTGAATATG
ATCATCATGCTTCCGGACGAGACCACTGACTTGAGAACGGTGGAGAAAGAACTCACTTACGAGAAGTTC
GTAGAATGGACGAGGCTGGACATGATGGATGAAGAGGAGGTGGAAGTGTCCCTCCCGCGGTTTAAACTA
GAGGAAAGCTACGACATGGAGAGTGTCCTGCGCAACCTGGGCATGACTGATGCCTTCGAGCTGGGCAAG
GCAGACTTCTCTGGAATGTCCCAGACAGACCTGTCTCTGTCCAAGGTCGTGCACAAGTCTTTTGTGGAG
GTCAATGAGGAAGGCACGGAGGCTGCAGCCGCCACAGCTGCCATCATGATGATGCGGTGTGCCAGATTC
GTCCCCCGCTTCTGCGCCGACCACCCCTTCCTTTTCTTCATCCAGCACAGCAAGACCAACGGGATTCTC
TTCTGCGGCCGCTTTTCCTCTCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271825
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271825.1
RefSeq Size 1576 bp
RefSeq ORF 1131 bp
Locus ID 5269
UniProt ID P35237
Protein Families Druggable Genome
MW 42.6 kDa
Gene Summary The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (6) contains an alternate 5' UTR exon, compared to variant 1. Variants 1, 5 and 6 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...