Small integral membrane protein 1 (SMIM1) (NM_001288583) Human Untagged Clone

CAT#: SC333385

SMIM1 (untagged) - Human small integral membrane protein 1 (Vel blood group) (SMIM1), transcript variant 2



  "NM_001288583" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Vel
Vector pCMV6-Entry
Sequence Data
>SC333385 representing NM_001288583.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGCCCCAGGAGAGCCACGTCCACTATAGTAGGTGGGAGGACGGCAGCAGGGACGGAGTCAGCCTA
GGGGCTGTGTCCAGCACAGAAGAGGCCTCACGCTGCCGCAGGATCTCCCAGAGGCTGTGCACGGGCAAG
CTGGGCATCGCCATGAAGGTGCTGGGCGGCGTGGCCCTCTTCTGGATCATCTTCATCCTGGGCTACCTC
ACAGGCTACTATGTGCACAAGTGCAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001288583
Insert Size 237 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288583.1
RefSeq Size 529 bp
RefSeq ORF 237 bp
Locus ID 388588
UniProt ID B2RUZ4
MW 8.7 kDa
Gene Summary This gene encodes a small, conserved protein that participates in red blood cell formation. The encoded protein is localized to the cell membrane and is the antigen for the Vel blood group. Alternative splicing results in different transcript variants that encode the same protein. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Small integral membrane protein 1产品

Customer Reviews 
Loading...