BLOC1S2 (NM_001282437) Human Untagged Clone
CAT#: SC333479
BLOC1S2 (untagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 4
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BLOS2; BORCS2; CEAP; CEAP11 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333479 representing NM_001282437.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTCTCCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCCTG GAAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAAACATTAGTAGG AACTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGGATCAGATCAATGTCATTGAA GAGCAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGGATGCATATTCAAAAAAACTGGAAGCCAAG TACAAGAAGCTGGAGAAGCGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282437 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282437.1 |
RefSeq Size | 2798 bp |
RefSeq ORF | 300 bp |
Locus ID | 282991 |
UniProt ID | Q6QNY1 |
MW | 11.5 kDa |
Gene Summary | This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235585 | BLOC1S2 (myc-DDK-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 4 |
CNY 1200.00 |
|
RG235585 | BLOC1S2 (tGFP-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 4 |
CNY 4370.00 |
其它BLOC1S2产品