BLOC1S2 (NM_001282437) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	BLOS2; BORCS2; CEAP; CEAP11
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333479 representing NM_001282437. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTCTCCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCCTG GAAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAAACATTAGTAGG AACTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGGATCAGATCAATGTCATTGAA GAGCAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGGATGCATATTCAAAAAAACTGGAAGCCAAG TACAAGAAGCTGGAGAAGCGATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001282437
Insert Size	300 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001282437.1
RefSeq Size	2798 bp
RefSeq ORF	300 bp
Locus ID	282991
UniProt ID	Q6QNY1
MW	11.5 kDa
Gene Summary	This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.