POLR1H (NM_001278785) Human Untagged Clone

CAT#: SC333732

ZNRD1 (untagged) - Human zinc ribbon domain containing 1 (ZNRD1), transcript variant c



  "NM_001278785" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ZNRD1 mouse monoclonal antibody, clone OTI1G2 (formerly 1G2)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A12.2; HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZNRD1; ZR14
Vector pCMV6-Entry
Sequence Data
>SC333732 representing NM_001278785.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGTCATGGACCTCGCCAATACTTGCTCCAGCTTTCAGTCGGACCTGGATTTCTGTTCAGATTGC
GGCTCGGTCCTGCCTCTGCCCGGGGCTCAGGATACGGTCACCTGTATTCGCTGTGGCTTCAACATCAAC
GTTCGGGACTTTGAGGGGAAGGTTGTGAAGACTTCGGTTGTGTTCCACCAACTGGGGACAGCCATGCCT
ATGTCGGTGGAGGAAGGGCCTGAGTGCCAGGGACCTGTGGTTGACAGGCGCTGCCCTCGATGTGGTCAT
GAAGGAATGGCATACCACACCAGACAGATGCGTTCAGCCGATGAAGGGCAAACTGTCTTCTACACCTGT
ACCAACTGCAAGTTCCAGGAGAAGGAAGACTCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001278785
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278785.1
RefSeq Size 760 bp
RefSeq ORF 381 bp
Locus ID 30834
UniProt ID Q9P1U0
Protein Families Transcription Factors
Protein Pathways Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 13.9 kDa
Gene Summary This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (c) differs in the 5' UTR, compared to variant a. Variants a, b, c, and d encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...