Cystatin C (CST3) (NM_001288614) Human Untagged Clone
CAT#: SC333931
CST3 (untagged) - Human cystatin C (CST3), transcript variant 2
CNY 2950.00
货期*
                        3周
                    规格
                        Product images
                    
                
                         推荐一起购买 (4)
                    
                    
                                        CST3 (Cystatin C) mouse monoclonal antibody, clone OTI2C8 (formerly 2C8)
                                    
                                
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | ARMD11; HEL-S-2 | 
| Vector | pCMV6-Entry | 
| Sequence Data | 
                
                
                
                 >SC333931 representing NM_001288614. 
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGGGCCCCTGCGCGCCCCGCTGCTCCTGCTGGCCATCCTGGCCGTGGCCCTGGCCGTGAGCCCC GCGGCCGGCTCCAGTCCCGGCAAGCCGCCGCGCCTGGTGGGAGGCCCCATGGACGCCAGCGTGGAGGAG GAGGGTGTGCGGCGTGCACTGGACTTTGCCGTCGGCGAGTACAACAAAGCCAGCAACGACATGTACCAC AGCCGCGCGCTGCAGGTGGTGCGCGCCCGCAAGCAGATCGTAGCTGGGGTGAACTACTTCTTGGACGTG GAGCTGGGCCGAACCACGTGTACCAAGACCCAGCCCAACTTGGACAACTGCCCCTTCCATGACCAGCCA CATCTGAAAAGGAAAGCATTCTGCTCTTTCCAGATCTACGCTGTGCCTTGGCAGGGCACAATGACCTTG TCGAAATCCACCTGTCAGGACGCCTAG  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_001288614 | 
| Insert Size | 441 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_001288614.1 | 
| RefSeq Size | 2209 bp | 
| RefSeq ORF | 441 bp | 
| Locus ID | 1471 | 
| UniProt ID | P01034 | 
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane | 
| MW | 15.8 kDa | 
| Gene Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. In addition, this protein has been shown to have an antimicrobial function, inhibiting the replication of herpes simplex virus. Alternative splicing results in multiple transcript variants encoding a single protein. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (2) represents the longer variant. Variants 1 and 2 encode the same protein.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
其它Cystatin C产品
                         Customer
                                Reviews 
                    
                    
                                Loading...
                            
                        