PLGF (PGF) (NM_001293643) Human Untagged Clone

CAT#: SC334128

PGF (untagged) - Human placental growth factor (PGF), transcript variant 3



  "NM_001293643" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-Human PlGF-1 Rabbit Polyclonal Antibody
    • 100 ug

CNY 3150.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D12S1900; PGFL; PIGF; PLGF; PlGF-2; SHGC-10760
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334128 representing NM_001293643.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGTCATGAGGCTGTTCCCTTGCTTCCTGCAGCTCCTGGCCGGGCTGGCGCTGCCTGCTGTGCCC
CCCCAGTGGGCCTTGTCTGCTGGGAACGGCTCGTCAGAGGTGGAAGTGGTACCCTTCCAGGAAGTGTGG
GGCCGCAGCTACTGCCGGGCGCTGGAGAGGCTGGTGGACGTCGTGTCCGAGTACCCCAGCGAGGTGGAG
CACATGTTCAGCCCATCCTGTGTCTCCCTGCTGCGCTGCACCGGCTGCTGCGGCGATGAGAATCTGCAC
TGTGTGCCGGTGGAGACGGCCAATGTCACCATGCAGCTCCTAAAGATCCGTTCTGGGGACCGGCCCTCC
TACGTGGAGCTGACGTTCTCTCAGCACGTTCGCTGCGAATGCCGGCCTCTGCGGGAGAAGATGAAGCCG
GAAAGGAGGAGACCCAAGGGCAGGGGGAAGAGGAGGAGAGAGAAGCAGAGACCCACAGACTGCCACCTG
TGCGGCGATGCTGTTCCCCGGAGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001293643
Insert Size 510 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293643.1
RefSeq Size 1908 bp
RefSeq ORF 510 bp
Locus ID 5228
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Bladder cancer, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma
MW 19.2 kDa
Gene Summary This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) has an alternate splice site in the 5' coding region, compared to variant 1. The resulting isoform (3) lacks an internal aa, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...