IFNL4 (NM_001276254) Human Untagged Clone
CAT#: SC334206
IFNL4 (untagged) - Human interferon, lambda 4 (gene/pseudogene) (IFNL4), transcript variant 1
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (2)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IFNAN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001276254, the custom clone sequence may differ by one or more nucleotides
ATGCGGCCGAGTGTCTGGGCCGCAGTGGCCGCGGGGCTGTGGGTCCTGTGCACGGTGATCGCAGCGGCCC CCCGGCGCTGCCTGCTCTCGCACTACCGCTCGCTGGAGCCCCGGACGCTGGCGGCTGCCAAGGCGCTGAG GGACCGCTACGAGGAAGAGGCGCTGAGCTGGGGGCAGCGCAACTGCTCCTTCCGCCCCAGGAGGGATCCT CCGCGGCCATCGTCCTGCGCTCGGCTCCGCCACGTGGCCCGGGGCATCGCGGACGCCCAGGCAGTGCTCA GCGGCCTGCACCGCTCGGAGCTGCTCCCCGGCGCCGGCCCGATCCTGGAGCTGCTGGCGGCCGCGGGGAG GGATGTGGCGGCCTGCCTTGAGCTGGCACGGCCAGGCTCCTCCAGGAAGGTCCCCGGGGCCCAGAAGAGG CGTCACAAACCCCGGAGAGCGGACTCGCCTCGGTGCCGCAAAGCCAGCGTGGTCTTCAACCTCCTGCGCC TGCTCACGTGGGAGCTCCGGCTGGCTGCACACTCTGGGCCTTGCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276254 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001276254.2, NP_001263183.2 |
RefSeq Size | 1636 bp |
RefSeq ORF | 540 bp |
Locus ID | 101180976 |
UniProt ID | K9M1U5 |
Gene Summary | This gene is a polymorphic pseudogene which, in some humans, encodes the interferon (IFN) lambda 4 protein. Humans are polymorphic for the dinucleotide TT/deltaG allele. Compared to the ancestral state in non-human primates, the TT allele produces a frameshift in the coding region of this gene which is predicted to induce nonsense-mediated mRNA decay. This allele, and an allele in the first intron of this gene, have experienced a rapid increase in frequency and show indications of positive selection. The ancestral states of these alleles are associated with an impaired ability to clear hepatitis C virus. This gene, like other type III interferons (IFNs), interacts with the IFN lambda receptor complex (IFNLR) whose signaling is generally restricted to epithelial cells. This gene resides in a cluster of four type III IFN genes and at least two pseudogenes on chromosome 19q13.2. In general, interferons are produced in response to viral infection and block viral replication and propagation to uninfected cells by activating the JAK-STAT pathway and up-regulating antiviral genes. Multiple alternatively spliced transcripts have been described for this gene but their biological validity and protein coding status is still being ascertained. [provided by RefSeq, May 2017] Transcript Variant: This variant (1) represents a protein coding transcript of this gene. Human populations are polymorphic for a frameshifting single nucleotide insertion in this transcript and thus transcripts with the alternate allele are non-coding. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...