ZFAND5 (NM_001278244) Human Untagged Clone

CAT#: SC334504

ZFAND5 (untagged) - Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant e



  "NM_001278244" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ZFAND5 mouse monoclonal antibody, clone OTI5H8 (formerly 5H8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZA20D2; ZFAND5A; ZNF216
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278244, the custom clone sequence may differ by one or more nucleotides


ATGGCTCAGGAGACTAACCAGACCCCGGGGCCCATGCTGTGTAGCACAGGATGTGGCTTTTATGGAAATC
CTAGGACAAATGGAATGTGTTCAGTTTGCTACAAAGAACATCTTCAGAGGCAGCAAAATAGTGGCAGAAT
GAGCCCAATGGGGACAGCTAGTGGTTCCAACAGTCCTACCTCAGATTCTGCATCTGTACAGAGAGCAGAC
ACTAGCTTAAACAACTGTGAAGGTGCTGCTGGCAGCACATCTGAAAAATCAAGAAATGTGCCTGTGGCTG
CCTTGCCTGTAACTCAGCAAATGACAGAAATGAGCATTTCAAGAGAGGACAAAATAACTACCCCGAAAAC
AGAGGTGTCAGAGCCAGTTGTCACTCAGCCCAGTCCATCAGTTTCTCAGCCCAGTACTTCTCAGAGTGAA
GAAAAAGCTCCTGAATTGCCCAAACCAAAGAAAAACAGATGTTTCATGTGCAGAAAGAAAGTTGGTCTTA
CAGGGTTTGACTGCCGATGTGGAAATTTGTTTTGTGGACTTCACCGTTACTCTGACAAGCACAACTGTCC
GTATGATTACAAAGCAGAAGCTGCAGCAAAAATCAGAAAAGAGAATCCAGTTGTTGTGGCTGAAAAAATT
CAGAGAATATAA


Restriction Sites SgfI-MluI     
ACCN NM_001278244
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278244.1, NP_001265173.1
RefSeq Size 5329 bp
RefSeq ORF 642 bp
Locus ID 7763
UniProt ID O76080
Gene Summary Involved in protein degradation via the ubiquitin-proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4-induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (e) differs in the 5' UTR compared to variant a. All six variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...