ZFAND5 (NM_001278244) Human Untagged Clone
CAT#: SC334504
ZFAND5 (untagged) - Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant e
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
ZFAND5 mouse monoclonal antibody, clone OTI5H8 (formerly 5H8)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZA20D2; ZFAND5A; ZNF216 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278244, the custom clone sequence may differ by one or more nucleotides
ATGGCTCAGGAGACTAACCAGACCCCGGGGCCCATGCTGTGTAGCACAGGATGTGGCTTTTATGGAAATC CTAGGACAAATGGAATGTGTTCAGTTTGCTACAAAGAACATCTTCAGAGGCAGCAAAATAGTGGCAGAAT GAGCCCAATGGGGACAGCTAGTGGTTCCAACAGTCCTACCTCAGATTCTGCATCTGTACAGAGAGCAGAC ACTAGCTTAAACAACTGTGAAGGTGCTGCTGGCAGCACATCTGAAAAATCAAGAAATGTGCCTGTGGCTG CCTTGCCTGTAACTCAGCAAATGACAGAAATGAGCATTTCAAGAGAGGACAAAATAACTACCCCGAAAAC AGAGGTGTCAGAGCCAGTTGTCACTCAGCCCAGTCCATCAGTTTCTCAGCCCAGTACTTCTCAGAGTGAA GAAAAAGCTCCTGAATTGCCCAAACCAAAGAAAAACAGATGTTTCATGTGCAGAAAGAAAGTTGGTCTTA CAGGGTTTGACTGCCGATGTGGAAATTTGTTTTGTGGACTTCACCGTTACTCTGACAAGCACAACTGTCC GTATGATTACAAAGCAGAAGCTGCAGCAAAAATCAGAAAAGAGAATCCAGTTGTTGTGGCTGAAAAAATT CAGAGAATATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278244 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278244.1, NP_001265173.1 |
RefSeq Size | 5329 bp |
RefSeq ORF | 642 bp |
Locus ID | 7763 |
UniProt ID | O76080 |
Gene Summary | Involved in protein degradation via the ubiquitin-proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4-induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (e) differs in the 5' UTR compared to variant a. All six variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...