KCNN2 (NM_001278204) Human Untagged Clone

CAT#: SC334650

KCNN2 (untagged) - Human potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 3



  "NM_001278204" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KCNN2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hSK2; KCa2.2; SK2; SKCA2; SKCa 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278204, the custom clone sequence may differ by one or more nucleotides


ATGTGGTTGATATCAATAACTTTTCTCTCCATTGGTTATGGTGACATGGTACCTAACACATACTGTGGAA
AAGGAGTCTGCTTACTTACTGGAATTATGGGTGCTGGTTGCACAGCCCTGGTGGTAGCTGTAGTGGCAAG
GAAGCTAGAACTTACCAAAGCAGAAAAACACGTGCACAATTTCATGATGGATACTCAGCTGACTAAAAGA
GTAAAAAATGCAGCTGCCAATGTACTCAGGGAAACATGGCTAATTTACAAAAATACAAAGCTAGTGAAAA
AGATAGATCATGCAAAAGTAAGAAAACATCAACGAAAATTCCTGCAAGCTATTCATCAATTAAGAAGTGT
AAAAATGGAGCAGAGGAAACTGAATGACCAAGCAAACACTTTGGTGGACTTGGCAAAGACCCAGAACATC
ATGTATGATATGATTTCTGACTTAAACGAAAGGAGTGAAGACTTCGAGAAGAGGATTGTTACCCTGGAAA
CAAAACTAGAGACTTTGATTGGTAGCATCCACGCCCTCCCTGGGCTCATAAGCCAGACCATCAGGCAGCA
GCAGAGAGATTTCATTGAGGCTCAGATGGAGAGCTACGACAAGCACGTCACTTACAATGCTGAGCGGTCC
CGGTCCTCGTCCAGGAGGCGGCGGTCCTCTTCCACAGCACCACCAACTTCATCAGAGAGTAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278204
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278204.1, NP_001265133.1
RefSeq Size 2112 bp
RefSeq ORF 696 bp
Locus ID 3781
UniProt ID Q9H2S1
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region and initiates translation at a downstream start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (b), which is shorter at the N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...