TGIF (TGIF1) (NM_001278686) Human Untagged Clone
CAT#: SC334837
TGIF1 (untagged) - Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 11
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
TGIF1 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPE4; TGIF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278686, the custom clone sequence may differ by one or more nucleotides
ATGGACATTCCCTTGGACCTTTCTTCATCCGCTGGCTCAGGCAAGAGAAGGAGAAGGGGCAACCTACCCA AGGAGTCTGTGCAGATTCTTCGGGATTGGCTGTATGAGCACCGTTACAATGCCTATCCTTCAGAGCAAGA AAAAGCGTTGCTGTCCCAGCAAACACACCTGTCTACGCTACAGGTCTGTAACTGGTTCATCAACGCCCGC CGCAGGCTCCTCCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCACAATTTCCCGCCGTG GGGCCAAGATTTCTGAAACGAGCTCTGTGGAGTCCGTGATGGGCATCAAAAACTTCATGCCAGCTCTAGA GGAGACCCCATTTCATTCCTGTACAGCTGGGCCAAACCCAACCCTAGGGAGGCCACTGTCTCCTAAGCCG TCATCCCCGGGATCAGTTTTGGCTCGTCCATCAGTGATCTGCCATACCACTGTGACTGCATTGAAAGATG TCCCTTTCTCTCTCTGCCAGTCGGTCGGTGTGGGACAAAACACAGATATACAGCAGATAGCGGCCAAAAA CTTCACAGACACCTCTCTCATGTACCCAGAGGACACTTGTAAATCTGGACCAAGTACGAATACACAGAGT GGTCTTTTCAACACTCCTCCCCCTACTCCACCGGACCTCAACCAGGACTTCAGTGGATTTCAGCTTCTAG TGGATGTTGCACTCAAACGGGCTGCAGAGATGGAGCTTCAGGCAAAACTTACAGCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278686 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278686.1, NP_001265615.1 |
RefSeq Size | 1553 bp |
RefSeq ORF | 759 bp |
Locus ID | 7050 |
UniProt ID | Q15583 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors |
Gene Summary | The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (11) includes two alternate 5' exons, which result in a different 5' UTR and a downstream translation start codon, compared to variant 1. The resulting isoform (d) has a shorter N-terminus, compared to isoform a. Variants 5, 6, 7, 8, and 11 encode the same isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...