RAB3IP (NM_001278402) Human Untagged Clone

CAT#: SC334859

RAB3IP (untagged) - Human RAB3A interacting protein (RAB3IP), transcript variant B



  "NM_001278402" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RAB3IP mouse monoclonal antibody,clone OTI5F2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RABIN3; RABIN8
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278402, the custom clone sequence may differ by one or more nucleotides


ATGGTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTG
ATGTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCA
GGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCT
ATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTAT
CCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGACAA
AATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAG
GCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTG
CAGTTGAATGCGGAGGACCAAAAAAATGTGCTCTCACTGGCCAGAGTAAGTCCTGTAAACACAGAATTAA
ATTAGGGGACTCAAGCAACTATTATTATATTTCTCCTTTTTGCAGATACAGGATCACTTCTGTATGTAAC
TTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGAAACAGCAGGATGTTGATCAGATGTTTTGGG
AGGTTATGCAGTTGAGAAAAGAGATGTCATTGGCAAAGCTGGGTTATTTCAAAGAGGAACTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278402
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278402.1, NP_001265331.1
RefSeq Size 8781 bp
RefSeq ORF 765 bp
Locus ID 117177
UniProt ID Q96QF0
Gene Summary Guanine nucleotide exchange factor (GEF) which may activate RAB8A and RAB8B. Promotes the exchange of GDP to GTP, converting inactive GDP-bound Rab proteins into their active GTP-bound form. Mediates the release of GDP from RAB8A and RAB8B but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (B) has multiple differences, which result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant alpha 2. The resulting isoform (A) has a shorter N-terminus, compared to isoform alpha 2. Variants A and B encode the same isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...