MAGEA2 (NM_001282504) Human Untagged Clone

CAT#: SC335280

MAGEA2 (untagged) - Human melanoma antigen family A, 2 (MAGEA2), transcript variant 6



  "NM_001282504" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MAGEA2 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT1.2; MAGE2; MAGEA2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335280 representing NM_001282504.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCCGAGGAGAGGCCCTG
GGCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGCAGACCGCTTCTTCCTCTTCTACTCTAGTG
GAAGTTACCCTGGGGGAGGTGCCTGCTGCCGACTCACCGAGTCCTCCCCACAGTCCTCAGGGAGCCTCC
AGCTTCTCGACTACCATCAACTACACTCTTTGGAGACAATCCGATGAGGGCTCCAGCAACCAAGAAGAG
GAGGGGCCAAGAATGTTTCCCGACCTGGAGTCCGAGTTCCAAGCAGCAATCAGTAGGAAGATGGTTGAG
TTGGTTCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGAGAGT
GTCCTCAGAAATTGCCAGGACTTCTTTCCCGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTGGTC
TTTGGCATCGAGGTGGTGGAAGTGGTCCCCATCAGCCACTTGTACATCCTTGTCACCTGCCTGGGCCTC
TCCTACGATGGCCTGCTGGGCGACAATCAGGTCATGCCCAAGACAGGCCTCCTGATAATCGTCCTGGCC
ATAATCGCAATAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTATGTTGGAGGTG
TTTGAGGGGAGGGAGGACAGTGTCTTCGCACATCCCAGGAAGCTGCTCATGCAAGATCTGGTGCAGGAA
AACTACCTGGAGTACCGGCAGGTGCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGG
GCCCTCATTGAAACCAGCTATGTGAAAGTCCTGCACCATACACTAAAGATCGGTGGAGAACCTCACATT
TCCTACCCACCCCTGCATGAACGGGCTTTGAGAGAGGGAGAAGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282504
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282504.1
RefSeq Size 1746 bp
RefSeq ORF 945 bp
Locus ID 4101
UniProt ID P43356
MW 35.1 kDa
Gene Summary This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) lacks three internal exons in the 5' UTR region, compared to variant 3. Variants 1 through 7 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...